Dataset for CDS BMF of organism Cavia porcellus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A286XXB0_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Cavia porcellus GN=BMF (length=570 residues).
gttttcccaagggagatggagccacctcagtgtgtggaggagctggaggatgatgtgttccaacccgaggatggggagcc
ggggacccagcctgggagcctgctctctgctgatctctttgcccagagccagctggactgtccccttggtcggctgcacc
tctttcctctcacccactgctgtggccctgggcttcgccccaccagccaggaagacaaggccactcagaccctcagccca
tcctctccaagccagggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggcta
ccggcttcctctccctgccagtttccctgcaggcttgccccttggggagcagccccctgaaggtcagtggcaacatcgag
cagaggtacagatcgcccggaagcttcagtgcattgcagaccagttccaccgacttcacattcaacaacaccaacagaac
cggaatcgcgcatggtggcaggtcttactcttcatgcacaacctgggtctgaacggagaagagaacagggaaggggcagg
tcccaggtga
>gnl|bcl2dbcds|A0A286XXB0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Cavia porcellus GN=BMF (length=711 residues).
atgcccggggcgggcgtattttggaaacaataccgcgcgcgccgccgccgccgcggacccgaccccccccgagtgttcgt
cacgctggaccctggcacagagccctggcaccacgactcggaggccgattctctctcctggagtcacccaggggagatgg
agccacctcagtgtgtggaggagctggaggatgatgtgttccaacccgaggatggggagccggggacccagcctgggagc
ctgctctctgctgatctctttgcccagagccagctggactgtccccttggtcggctgcacctctttcctctcacccactg
ctgtggccctgggcttcgccccaccagccaggaagacaaggccactcagaccctcagcccatcctctccaagccagggtg
tcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccctgcc
agtttccctgcaggcttgccccttggggagcagccccctgaaggtcagtggcaacatcgagcagaggtacagatcgcccg
gaagcttcagtgcattgcagaccagttccaccgacttcacattcaacaacaccaacagaaccggaatcgcgcatggtggc
aggtcttactcttcatgcacaacctgggtctgaacggagaagagaacagggaaggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A286XXB0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Cavia porcellus GN=BMF (length=555 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccaacccgaggatggggagccggggacccagcctgg
gagcctgctctctgctgatctctttgcccagagccagctggactgtccccttggtcggctgcacctctttcctctcaccc
actgctgtggccctgggcttcgccccaccagccaggaagacaaggccactcagaccctcagcccatcctctccaagccag
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttccctgcaggcttgccccttggggagcagccccctgaaggtcagtggcaacatcgagcagaggtacagatcg
cccggaagcttcagtgcattgcagaccagttccaccgacttcacattcaacaacaccaacagaaccggaatcgcgcatgg
tggcaggtcttactcttcatgcacaacctgggtctgaacggagaagagaacagggaaggggcaggtcccaggtga
© 1998-2018