Dataset for CDS BIK of organism Cavia porcellus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H0W025_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Cavia porcellus GN=BIK (length=477 residues).
atgtcggaagcaaaacctgtcgccagggacccactgatggagaccccgctgtttgagccaccccctgggcctctgctggc
tgaaggggctttgggtgtgacgcagccactgtgggcagaggacctcagtccccctggggacactaacctcatggaatgcg
tggaaggcagcagcctggtggccctgcggctggcctgcatcggtgacgagatggacctgcgcctacggagcccccgcctg
gcccagctgccagggagggcagtgcacagcctggccatcacttacagccagatggggctctggggtgtgctcggaaggct
gaccctcagtctcgccagcctcagggacaatgtgtgggcctgtggacgcccagcctcccgtgcctgggtgtccccccgct
ggacctgcaggtggctgctgcctgtgctgctgttgctgctgctgctgctggggaccctgcgcctgctgctgcagtga
© 1998-2018