Dataset for CDS Unclassified of organism Carassius auratus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3G3M2I9_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Carassius auratus (length=267 residues).
atgtctgacacgtccgaggtatggtttgccgaacctagccaccagcacgtgcagatggcagcacctgtgggagccatggg
gccggagatttcggtcgctcgggagctgcggcgcattggagacgagttcaaccgcttgtactgtcaaggggccggtgcag
gtgggaacaacagagcccagctgcatgctcccaatgaacacgccatcatcatgtggatgaacgaccttatcggacgtgta
gtacagtttttcctgcgaagaagatga
© 1998-2019