Dataset for CDS BCL2L11 of organism Carassius auratus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3G3M2M0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Carassius auratus GN=BCL2L11 (length=546 residues).
atgtctgacacgtccagagagcaaacgccgggtaatgtcccggcgtcgcggggaagtggagagagcgccggtgtcggagc
tgcgttgcgccccgggcactttgacttccctcagccgagcgatggggacccgttaaggggagggattgccatgtcgaata
gtcaccagtcgaggtcaccgatgtcccgaaccttctccaggtcctctagtggctatttttccgtcgacagcgattctgtg
ccgggttctccgctattgcccaatatttccgaagcgcaagacgaccaaaatgatgaggtatggtttgccgaacctagcca
ccagcacgtgcagatggcagcacctgtgggagccatggggccggagatttcggtcgctcgggagctgcggcgcattggag
acgagttcaaccgcttgtactgtcaaggggccggtgcaggtgggaacaacagagcccagctgcatgctcccaatgaacac
gccatcatcatgtggatgaacgaccttatcggacgtgtagtacagtttttcctgcgaagaagatga
© 1998-2019