Dataset for CDS classical BH3-containing proteins of organism Capra hircus

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A452DXE5_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Capra hircus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgtggccccccggccgtgtgcgcctgcagcgccggccgtctgggtctgcgctc
gtccgccgcgcagctcacggccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccctacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A452E3G1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Capra hircus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctcccccgagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgtggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcactgccgccctgggggccccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcacctggaatcgcc
agtgcccagcgccccgggggccctggcgggcggacccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcgg
caacgacaccgcccctcgccctggagggtcctgtacaatctcatcttgggactcctgcccttccccgggggccgcggagc
ccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A452ER54_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Capra hircus GN=BAD (length=528 residues).
tatcgggcttgggcccagagcatgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagatag
gggcctgggccccagccccacaggggacaggcccccaggtctcagcaagcactggctaacagccccgggcctcctggggg
aagctggtcaccagcaggggcagccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcac
agctcctaccccgcggggccagaggatgatgaagggacggaggaggaggatctcggcccctttaggggccgctcgcgttc
ggcgccccccaacctctgggctgcacagcgatatggccgcgagctccgaaggatgagcgacgagtttcacgtctccttca
aggggcttcctcgcccgaagagcgcgggaacggcaacgcaaatgcgacaaagccctagctggacgcgcttcctccagtcc
tggttgagccggaacttggggaggggaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A452ER54_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Capra hircus GN=BAD (length=597 residues).
atggggaccccggagaatccctcagcggctcccacaactcggaagctgagcatccggagacgtagaagagaatcaggagg
aaggcagtgggcggggccccggggaagcatgttccagatcccagagtttgagcagagtgagcaggaagactccagccctg
cagataggggcctgggccccagccccacaggggacaggcccccaggtctcaccccgggcctcctgggggaagctggtcac
cagcaggggcagccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccc
cgcggggccagaggatgatgaagggacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgcccccca
acctctgggctgcacagcgatatggccgcgagctccgaaggatgagcgacgagtttcacgtctccttcaaggggcttcct
cgcccgaagagcgcgggaacggcaacgcaaatgcgacaaagccctagctggacgcgcttcctccagtcctggttgagccg
gaacttggggaggggaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A452EST2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Capra hircus GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgtaggagcgcccagccgagccccacgcgggtcccggcagatcctgaagttgagtgtgccat
tcagttgaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatagccaaactcctccgctcaggaa
cttga
>gnl|bcl2dbcds|A0A452F2E0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Capra hircus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagccagaggatggggaaccaggggcccagcccag
gaggttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgcctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggcaatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcaaccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaacatcagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctgcacaacgtggctttgaatggagatgagaacaggaatggggcaggccccaggtga
>gnl|bcl2dbcds|A0A452F2E0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Capra hircus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagccagaggatggggaaccaggggcccagcccag
gaggttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgcctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggcaatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcaaccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaacatcagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctgcacaacgtggctttgaatggagatgagaacaggaatggggcaggccccaggtga
>gnl|bcl2dbcds|A0A452FCS1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Capra hircus GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccaggggcccccacctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
gcagcccgcagggcccgctggccccaccggccagccccggccctttcgctaccagatccccgctcttcatcttcgtgaga
agatcctccttgctgtctcggtcctccagcgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcgtat
tacccaagaagggtcttcgtgcgtcaccaggcgattgagggccacccacaaatggtcctcctgcgcgtcttgcgctacct
ggtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A452FCS1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Capra hircus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccaggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcgtattacccaag
aagggtcttcgtgcgtcaccaggcgattgagggccacccacaaatggtcctcctgcgcgtcttgcgctacctggtgcgtc
tggtgtggaggatgcagtga
© 1998-2019