Dataset for CDS HRK of organism Canis lupus familiaris

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|E2RLD4_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Canis lupus familiaris GN=HRK (length=273 residues).
atgtgcccgtgccccctgcaccgcggccgcgggcccccggccgtgtgcgcctgcagcgcgggccgcctggctctgcgctc
gtccgccgcgcagctcacggccgctcggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgccccgcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttg
© 1998-2019