Dataset for CDS classical BH3-containing proteins of organism Canis lupus familiaris

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|E2RLD4_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Canis lupus familiaris GN=HRK (length=273 residues).
atgtgcccgtgccccctgcaccgcggccgcgggcccccggccgtgtgcgcctgcagcgcgggccgcctggctctgcgctc
gtccgccgcgcagctcacggccgctcggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgccccgcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttg
>gnl|bcl2dbcds|F1PK10_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Canis lupus familiaris GN=BAD (length=624 residues).
accccagagaatccctcatctgctcccgcgcaggacccaggcacaaggaagtcaggaaccgagcggcgggagaagagctg
tgccctaactacctgctgtcttgcccccacagcccagagcatgttccagatcccagagtttgagcccagtgagcaggaag
actccagccctgcaaataggggcttgggccccagccccacaggggaccggcccccaagccctggcaagcaccagcagacg
gccccaggcctcctaggggaagctggtcaccagcaggggcagccagccagccgcaaacaccatggaggcgctggggctga
gacccggagtcgccacagctcgttccccgcggggaccgacgaggatgaaggaatggaggaagaagagctcagccctttcc
gggggcgctcgagctcagcgccccccaacctctgcgcggcacggcgctacggccgcgagctccgcaggatgagcgacgag
ttccagggctccttcaagggacttcctcgcccgaagagcgcggggacagcgacgcagatgcgacaaagccccagctggac
gcgcgtcatccagtcctggtgggatcggaacttggggagaggaggctccgccccgtcccagtga
>gnl|bcl2dbcds|F1PUF4_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Canis lupus familiaris GN=BIK (length=450 residues).
atgtctcactcaggacccctctccaggaacctctttctgagcaccttcctgcaggagcatggcccagaagttctggaggt
tccgggcatgacagatctcgtggagtattatgaccctgggccctcccctaacagcaacaaccccgacgatgtggccatgc
ggctggccttcatcggggacgagatggaagtgagatggatgcttccccgcgttggcgagctgcccgggatggccatgtac
agcttggcttttacctacaaccagacaggcctgagaggtgttcttagaagtttcctggatggtcttgctaacctcaggga
gaacatccgcatctggagcttcctgaccttccggaacagggtgtcccccaacccggggcgcgggctggtgctgtcgctgc
tgctgctgctggtgctgctactaggctggggcctccgcctcctccagtga
>gnl|bcl2dbcds|J9NTK9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Canis lupus familiaris GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggtccgcgcccgtttcccct
cagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcccctgctgcccctgccctgc
tgcccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactgtcgccggcggaacagcacctggaatcgcc
ggtgcccagcgccccgggggccctggcgggcggtcccacccaagcagccccgggagtccggggggaggaggagcagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccgtggagc
cccggagatggagcccaattag
>gnl|bcl2dbcds|J9NWV6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttttgaataattaccaagcagccgaagcccacccccaaatgattatcttacgactgttacgtta
catcgtccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|J9PB65_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=612 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccaagtcag
ggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagcttccagct
agtcccgggaatatcgtgctctggagctcagcaggattgcagctgcctctga
>gnl|bcl2dbcds|Q1PCT2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Canis lupus familiaris GN=PMAIP1 (length=165 residues).
atgcccggccggaaggcgcgcaagagcgcgcagcccggccccacgcgggcccccgaagagctcgaagtggagtgtgccat
tcagctcaggaaatttggagacaaactgaatttccggcagaaacttctgaatctgttatccaaactcttccgctcaggaa
cctga
>gnl|bcl2dbcds|Q45KI9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Canis lupus familiaris GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcaaataggggcttgggccccagccccac
aggggaccggcccccaagccctggcaagcaccagcagacggccccaggcctcctaggggaagctggtcaccagcaggggc
agccagccagccgcaaacaccatggaggcgctggggctgagacccggagtcgccacagctcgttccccgcggggaccgac
gaggatgaaggaatggaggaagaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgcgcggc
acggcgctacggccgcgagctccgcaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaagagcg
cggggacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttggggaga
ggaggctccgccccgtcccagtga
© 1998-2018