Dataset for CDS BMF of organism Canis lupus familiaris

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|J9PB65_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Canis lupus familiaris GN=BMF (length=612 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccaagtcag
ggtgtcatgctgccttgtggggtgaccgaagagccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgcctctcctcgagcagcccccggaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagattctcctcttcctgcacaacctggctttgaatgcagatgagaacaggaatggggcaggtcccagcttccagct
agtcccgggaatatcgtgctctggagctcagcaggattgcagctgcctctga
© 1998-2018