Dataset for CDS BAD of organism Canis lupus familiaris

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|F1PK10_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Canis lupus familiaris GN=BAD (length=624 residues).
accccagagaatccctcatctgctcccgcgcaggacccaggcacaaggaagtcaggaaccgagcggcgggagaagagctg
tgccctaactacctgctgtcttgcccccacagcccagagcatgttccagatcccagagtttgagcccagtgagcaggaag
actccagccctgcaaataggggcttgggccccagccccacaggggaccggcccccaagccctggcaagcaccagcagacg
gccccaggcctcctaggggaagctggtcaccagcaggggcagccagccagccgcaaacaccatggaggcgctggggctga
gacccggagtcgccacagctcgttccccgcggggaccgacgaggatgaaggaatggaggaagaagagctcagccctttcc
gggggcgctcgagctcagcgccccccaacctctgcgcggcacggcgctacggccgcgagctccgcaggatgagcgacgag
ttccagggctccttcaagggacttcctcgcccgaagagcgcggggacagcgacgcagatgcgacaaagccccagctggac
gcgcgtcatccagtcctggtgggatcggaacttggggagaggaggctccgccccgtcccagtga
>gnl|bcl2dbcds|Q45KI9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Canis lupus familiaris GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcaaataggggcttgggccccagccccac
aggggaccggcccccaagccctggcaagcaccagcagacggccccaggcctcctaggggaagctggtcaccagcaggggc
agccagccagccgcaaacaccatggaggcgctggggctgagacccggagtcgccacagctcgttccccgcggggaccgac
gaggatgaaggaatggaggaagaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgcgcggc
acggcgctacggccgcgagctccgcaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaagagcg
cggggacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttggggaga
ggaggctccgccccgtcccagtga
© 1998-2018