Dataset for CDS classical BH3-containing proteins of organism Callithrix jacchus

[Download (right click)] [Alignment] [Repertoires]

18 sequence(s)

>gnl|bcl2dbcds|A0A2R8MW85_BBC3-03 BCL2 binding component 3 gene OS=[Eukaryota] Callithrix jacchus GN=BBC3 (length=396 residues).
atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccagggcttcttcctcggtgtgggtcccctgcca
gatgtgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccaggggccctgg
cgggcggtcccacccaggcggcccccggagtccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcga
cggatggcggacgacctcaacgcgctgtacgagcggcggagacaagaggagcagccgcagcaccgcccctcgccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccaggggccacagagccccggagatggagcccaattag
>gnl|bcl2dbcds|A0A2R8MW85_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Callithrix jacchus GN=BBC3 (length=786 residues).
atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccagggcttcttcctcggtgtgggtcccctgcca
gatgtgtggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcttggcccgc
gacggcccgcgccccttcccgcttggccgcctggtgccctcggccgtgtcctgcggcctctgcgagtccggcctgcccgc
cacccccgccgcccccgccttgctgcccgctgcctacctctgcgcccccgccgccccacccgccgtcaccgccgccctgg
ggggcccccgctggcctgggggcccccgcagccgcccccgaggcccgcgcccggacggtcctcagccctcgctctcgctg
gcggagcagcacctggagtcgcccgtgcccagcgccccaggggccctggcgggcggtcccacccaggcggcccccggagt
ccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcgacggatggcggacgacctcaacgcgctgtacg
agcggcggagacaagaggagcagccgcagcaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctg
ccctttcccaggggccacagagccccggagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggacttg
gggggcaggcccctcccatctcctgacaccctggccagcgcgggggactttctctgcaccatgtag
>gnl|bcl2dbcds|F6SJL0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Callithrix jacchus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agtcaaccagcagcagccaccatggaggcgctggggctgtggagacccggagtcgccacagctcgtaccccgcagggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcgctcggcaccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgatgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcatccagtcctggtgggataggaacttgggc
aggggaggctccgctccttcccagtga
>gnl|bcl2dbcds|F6SJL0_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Callithrix jacchus GN=BAD (length=450 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agtcaaccagcagcagccaccatggagagaatcccagtgtaaggatgttctcgaaagcatcagcagggatgtccgcccca
gccactgactcagaagcccaacacacagagaatgtaaagctggaggcgctggggctgtggagacccggagtcgccacagc
tcgtaccccgcagggacggaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcgctcggcacc
ccccaacctctgggcagcacagcgctatggccgcgagctccggaggatga
>gnl|bcl2dbcds|F6XMC1_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|F6XMC1_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggatatctcttctacctgattga
>gnl|bcl2dbcds|F6XMC1_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggttagagaaatag
>gnl|bcl2dbcds|F6XMC1_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=546 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggataca
gactcactggtcagcagccatgtctgccctggaaagtgaggggcatcggggagaagcaggaagaacgtgtgaacccacac
acatgggagaccttcaaaagcaccagaactcacagtctttcagcacgtaattctatacatccttaa
>gnl|bcl2dbcds|F6XMC1_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=336 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatccgaatggatataggtgat
atttcattgtggtttagatttacatttaccttctttgatttgtgtggccaccaccacagtcaaggtacagaacaacagca
caaggatttctcatgg
>gnl|bcl2dbcds|F6XMC1_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|F6XMC1_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtatttttgaataattaccaagcagctgaagaccacccacacatggttatcttacg
actgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|F6XMC1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=612 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctgaa
cctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
gagggtaaactggatactgcccttttgccatcggaaggaagtgtgtcttgaagcattcccggttttaccatcgaaagcca
gccagagtgcttactggaccacaatcagagatcgttcaatcaatacttgctgtgccaaagcccaaagaattatttctggt
aatattctccaatctgtggccagatggtgccaaatgatgttgaccccacagctgtacttggttctcaaggacggtggccc
cgtggtcaaatctgctttaaaactgccatggttccactctccagtggcatga
>gnl|bcl2dbcds|F6XMC1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=792 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtaaactggatactgcccttttgccatcggaaggaagtgtgtcttgaagcattccc
ggttttaccatcgaaagccagccagagtgcttactggaccacaatcagagatcgttcaatcaatacttgctgtgccaaag
cccaaagaattatttctggtaatattctccaatctgtggccagatggtgccaaatgatgttgaccccacagctgtacttg
gttctcaaggacggtggccccgtggtcaaatctgctttaaaactgccatggttccactctccagtggcatga
>gnl|bcl2dbcds|F7FUT7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Callithrix jacchus GN=BIK (length=468 residues).
atgtctgaagtaagacccctctccagtgacatcttcatggagaccctcctgtgtgagcagttcgtggatcccctgaccat
ggaggttgttggtgggagtgaccctgaagaggacctggaccctgtggaggaccctttggaatgcatggagaacagtgacg
cactggccctgcagctggcctgcatcgcggaccagatggatgtgagcctcagggcccggaggctggcccagctctacgag
gtggccatgtacagcccgggtctcgctttcgtcctcgaccggaccgacatcggggatgttcttagcggtgtcgtggatgt
tttcgctaacttccaggaggacatagtgaggctctggagatccctgagctccgggtcctgggtgtcccgcaaacaggcag
tgctgctagcactcctggcgctgctgctggcgatgttcagtgggggtctgcacctgctgctcaagtga
>gnl|bcl2dbcds|F7GW45_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Callithrix jacchus GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagagcgcgcaaccgagccccgcgcgggctccagcagaccttgaagtcgagtgtgccac
tcaactcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|F7HPK0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Callithrix jacchus GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctatttgcccagagcctactggactgccccctcagtcggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgccccttggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgcatgtgg
tggcaggtcctcctcttcctgcacaacctggctttgaatggagaagagaacaggaatggggcaggcccgaggtga
>gnl|bcl2dbcds|F7HPK0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Callithrix jacchus GN=BMF (length=390 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctatttgcccagagcctactggactgccccctcagtcggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttacgcaccagcagaaccgaaatcgcatgtggt
ggcaggtcctcctcttcctgcacaacctggctttgaatggagaagagaacaggaatggggcaggcccgag
>gnl|bcl2dbcds|U3E722_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Callithrix jacchus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtttgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
© 1998-2018