Dataset for CDS BAD of organism Callithrix jacchus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|F6SJL0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Callithrix jacchus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agtcaaccagcagcagccaccatggaggcgctggggctgtggagacccggagtcgccacagctcgtaccccgcagggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcgctcggcaccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgatgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcatccagtcctggtgggataggaacttgggc
aggggaggctccgctccttcccagtga
>gnl|bcl2dbcds|F6SJL0_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Callithrix jacchus GN=BAD (length=450 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agtcaaccagcagcagccaccatggagagaatcccagtgtaaggatgttctcgaaagcatcagcagggatgtccgcccca
gccactgactcagaagcccaacacacagagaatgtaaagctggaggcgctggggctgtggagacccggagtcgccacagc
tcgtaccccgcagggacggaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcgctcggcacc
ccccaacctctgggcagcacagcgctatggccgcgagctccggaggatga
© 1998-2018