Dataset for CDS egl-1 of organism Caenorhabditis japonica

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2H2IAN0_EGL1-01 Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis japonica GN=egl-1 (length=327 residues).
atgctcgcattcacaacttctccatccacgtcctccattctgctctcgcattttgacgacatttccacgtccgtgtgctc
atctaaagacatgttcttctcctatgccacaccatcttgctctctggaggttactgctgattctgatgactcgctcgatg
attccggattctttgacgactccgacgccatccaaattggccgcgaaattggcgcacgcatcgccaccatgtgcgacgag
tttgacgccgagctgatgtcattcgccaactaccccgccaaggacagaggtcttcttgcacgtgtcctcgactttttcgc
cttctga
© 1998-2018