Dataset for CDS Unclassified of organism Caenorhabditis elegans

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q9TY06_uncEGL1-01 Putative Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis elegans (length=297 residues).
atgatgtcgtacaagcgtgatggatatttttcaattgtgtcaagctgcctaattttttgtctacactttctcccgctgtt
gtctattaggaccaaattaagctccctgtttatcacttctctcgcaaataatgcttgcaactcaaacaccgttgaatata
atattggcagaaaactgacagttatgtgcgacgagtttgactctgaactgatgtcctacaaagaagaaaaatcatttgtg
aaatttctaggctcaggattcaagacgtatgccagcattgttcgtcgtgttttttaa
© 1998-2018