Dataset for CDS classical BH3-containing proteins of organism Caenorhabditis elegans

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|O61667_EGL1-01 Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis elegans GN=egl-1 (length=321 residues).
atgctgatgctcacctttgcctcaacctcttcggatcttctaccaatgtccaacgtttttgacgttcaatcttccgtttt
ctacaacgaaaagaacatgttctactcctcgtctcaggacttctcctcgtgtgaagattcttctcaatttgccgacgact
cgggattttttgatgactctgagatcagcagcatcggctacgagatcggctccaagctagcagcaatgtgcgatgacttc
gatgctcagatgatgtcctactcggcccatgcttccgacagaagcctcttccatcgtcttctggactttttcgcttttta
a
© 1998-2018