Dataset for CDS PMAIP1 of organism Bos taurus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q1NFP6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Bos taurus GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgtaagagcgcccagccgagccccacgcgggtcccggcagatcctgaagttgaatgtgccat
tcagttgaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctccgctcaggaa
cttga
© 1998-2019