Dataset for CDS HRK of organism Bos taurus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G3MWR6_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Bos taurus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgccggccgcctgggtctgcgctc
gtccgccgcgcagctcacggcagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgtccggcgcgctccctacctactggccctggctgtgcgcggccgcgcaggtggcagcg
ctggcggcctggctgctcggcaggcggaacttgtag
© 1998-2018