Dataset for CDS classical BH3-containing proteins of organism Bos taurus

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|F1MUT9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Bos taurus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggacaggcccccaggtctcagcaagcactggctaacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccgcgcggggcca
gaggataatgaagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgccccccaacctctgggc
tgcacagcgatatggccgcgagctccggaggatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
gcgcgggcacggcaacgcaaatgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg
agaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|Q05KI3_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Bos taurus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcccgaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggccatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaataccagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaacggggcaggccccaggtga
>gnl|bcl2dbcds|Q05KI3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Bos taurus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcccgaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggccatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaataccagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaacggggcaggccccaggtga
>gnl|bcl2dbcds|Q2YDF0_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Bos taurus GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagacctggggcccccacctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
gcagcccacagggcccgctggccccaccggccagccctggccctttcgctaccagatccccgctcttcatcttcgtgaga
agatcctccttgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatat
tacccaagaagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacat
cgtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|Q2YDF0_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Bos taurus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagacctggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatattacccaag
aagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacatcgtgcgtc
tggtgtggaggatgcagtga
>gnl|bcl2dbcds|Q2YDF0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Bos taurus GN=BCL2L11 (length=516 residues).
atgccgctcagcgtgcggagttacttgtggatttggctggggtcgccaggagccggcttgggggaccttgctcccattcg
gagaaaaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctg
ccgagaggcctcctcagctcagacctggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatg
agttgtgacaaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgag
gcagtctcaggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagttta
atgcatattacccaagaagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttg
cgctacatcgtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|Q3SYZ0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Bos taurus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccgtgcagataggggcctgggccccagccccac
aggggacaggcccccaggtctcagcaagcactggctaacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccgcgcggggcca
gaggataatgaagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgccccccaacctctgggc
tgcacagcgatatggccgcgaactccggaggatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
gcgcgggcacggcaacggaaatgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg
agaggaggctccgccccctcccagtga
© 1998-2019