Dataset for CDS BBC3 of organism Bos taurus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q1LXZ6_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Bos taurus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgcggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctgggggccccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcacctggaatcacc
agtgcccagcgccccgggggccctggcgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcgg
cagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccctttcccgggggccgcggagc
ccccgaggtggagcccaattag
© 1998-2019