Dataset for CDS BAD of organism Bos taurus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|F1MUT9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Bos taurus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggacaggcccccaggtctcagcaagcactggctaacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccgcgcggggcca
gaggataatgaagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgccccccaacctctgggc
tgcacagcgatatggccgcgagctccggaggatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
gcgcgggcacggcaacgcaaatgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg
agaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|Q3SYZ0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Bos taurus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccgtgcagataggggcctgggccccagccccac
aggggacaggcccccaggtctcagcaagcactggctaacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccgcgcggggcca
gaggataatgaagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgccccccaacctctgggc
tgcacagcgatatggccgcgaactccggaggatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
gcgcgggcacggcaacggaaatgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg
agaggaggctccgccccctcccagtga
© 1998-2018