Dataset for CDS BMF of organism Bos mutus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|L8IXF5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Bos mutus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcccgaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggcaatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcaaccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaataccagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaacggggcaggccccaggtga
© 1998-2019