Dataset for CDS BCL2L11 of organism Astyanax mexicanus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B1JXK6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Astyanax mexicanus GN=BCL2L11 (length=612 residues).
atgtccagaccgtcaaaccgggccacccgcccacccttcttaaaggagcagggggaacgcggccagagcggcgggggcgg
cggaacattgtcccgagccgagcagtgcgagcagcctgagcccggcgatggcgacccggttaggggaccccctgcgctgc
acaatagccttctcggttaccagacccggtcgccgctgttccgaactctctccaggtcctcgagtggatatttctcgttc
gacagcgagcccagctccccgctcctgatgcacagcgcgtccactcagaccccgagtccatctagccaagtcataattca
cgcccttcagcgcatttccgaggcgcgaggcgacgctcagagtttcgagttatgtccaggacctaaccactgtccacccc
acagagcagcggctgcgggggacatgcaagcgcattggtacatcgcgcaagagttgcgacgcattggggatgaattcaac
gatctgtacttccgaggggcaggcagaaatggaggtggtgcccaacttcctgcacaaaatgaacccgccttcatactgtg
gatggggctcctgattgaacgtctccgacagttcctccacagaagaagatga
© 1998-2019