Dataset for CDS BAD of organism Astyanax mexicanus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3B1IH05_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Astyanax mexicanus GN=BAD (length=540 residues).
atgtccacagcggcgagagcggcggcggggacctgcgactccactgctgtcagccagccgtccaaactcgatttcacaat
ggatcacatgttcacaatatctgatgagtcagatgcatctgaagagctaggagactcagaccagccagaggtcagtaaga
cagctgagccatcgcggtctgggcagcacatcactgttccggagaaactcagagtagagcccaggcaaaggaatttttct
atgaatgaagaggctctgcaggagtctggtgctgggagacacgaagatggagctcgagatggagattcattccgacgccg
cagccgctcagctcccccttctctgtgggcagccaagaaatatggccgacagctgaggaagatgagtgacgagtttgaca
aggggctagagcaagggatgaagagggtgaggagtgccggagcagcccgccagatgcaaaactcccccagctggtttgcc
tttctttggagtcacaaggaatcagactctgaggcgagcagcagccgtccagcagaatga
>gnl|bcl2dbcds|A0A3B1JLM2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Astyanax mexicanus GN=BAD (length=642 residues).
atgagcaatcagtatctgctaaaactgaggagagctcgttttaattgcgacgaggagggatatagccaagcacttaacag
cagaacatcgactgaaggaggggggagagatacgcttttcaggccattgtgctggaattcatctggaagcacagttttca
caatggaaaagacaccaccacacagtaaagaagatgacatcagtcccatagatgaccacgatgaatcaaggtggtcagag
gcagtcaagagtgtcgactccccacagacggacagcgggcccagcatgtacagggacacatcatcagacgagctgttgga
ggtggggggtcgagtgaggctctactcagagtcccaagtgtacaacatcaaccgctgggaggacaatgagaaccaggatg
gcgcttcagcagaggacggtggtgtcggtgacggagcaccattccgaggccgatcccagtcagctcctgctgcgctatgg
aaagccaagaaatatggacggcagttgaggaggatgagcgatgagtttgacacctggttggacaaaggggacttaagaag
aacaactggccctgggaggcataccaaccgaggatggttctctttcctctggggtaccaaagaagaggagggaagagaat
aa
© 1998-2019