Dataset for CDS BAD of organism Astyanax mexicanus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|W5KIV3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Astyanax mexicanus GN=BAD (length=315 residues).
gggggtcgagtgaggctctactcagagtcccaagtgtacaacatcaaccgctgggaggacaatgagaaccaggatggcgc
ttcagcagaggacggtggtgtcggtgacggagcaccattccgaggccgatcccagtcagctcctgctgcgctatggaaag
ccaagaaatatggacggcagttgaggaggatgagcgatgagtttgacacctggttggacaaaggggacttaagaagaaca
actggccctgggaggcataccaaccgaggatggttctctttcctctggggtaccaaagaagaggagggaagagaa
>gnl|bcl2dbcds|W5KW69_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Astyanax mexicanus GN=BAD (length=468 residues).
atggatcacatgttcacaatatctgatgagtcagatgcatctgaagagctaggagactcagaccagccagaggtcagtaa
gacagctgagccatcgcggtctgggcagcacatcactgttccggagaaactcagaggtgagtcagtgtctaggcaaagga
atttttctatgaatgaagaggatctgcaggagtctggtgctgggagacacgaagatggagctcgagatggagattcattc
cgacgccgcagccgctcagctcccccttctctgtgggcagccaagaaatatggccgacagctgaggaagatgagtgacga
gtttgacaaggggctagagcaagggatgaagagggtgaggagtgccggagcagcccgccagatgcaaaactcccccagct
ggtttgcctttctttggagtcacaaggaatcagactctgaggcgagcagcagccgtccagcagaatga
© 1998-2018