Dataset for CDS classical BH3-containing proteins of organism Astatotilapia calliptera

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A3P8NFE2_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Astatotilapia calliptera GN=BMF (length=513 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagctcgtcggggatcacagagcgagtcga
caaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggcctgcat
tggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaactggtgaaagcaagtagaatacaaacat
gctggctggaaactgctgaagcttatgcaacaccctgcaaagttcaccacagtgtgataacggtatggaaacccagaggc
ttatcacagtggcagttcttgactgttaactag
>gnl|bcl2dbcds|A0A3P8NFE2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Astatotilapia calliptera GN=BMF (length=492 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagctcgtcggggatcacagagcgagtcga
caaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcgacccgcggctcgcagcgtggaggcctgcat
tggacagaaactccagctcataggagaccagtttcactgggaacgcctgcaactgtatcaccgaaaccaaaggaaccagg
ggccgatgtggtggcgcctggccgcggccattctcagccttctgtttgatagggggttcatagccggaggagggggtgga
ggacggaggtga
>gnl|bcl2dbcds|A0A3P8QRJ7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Astatotilapia calliptera GN=BAD (length=477 residues).
atggctgcaaacttcaaaatttcagacagtgattcagaggcatcagaggaggtaggggaaggagaaaaccaacagtcagc
aggacaagctcaagaaagcaagccccagacactttcccttcctgtaaccaaaacgacagctgctggaaggctcagggtga
actcagagtcccacacttcctcaattgccagggatgaggagctcatggctagaggggaggatgaggtctgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggcagcttcg
acgaatgagtgacgagtttgacagcttactagataaaggggagatgaaggtcaagaagctgcaccactctaaaacctggt
ggagctatctctttagtcaccaagagactgaaggagagaacaaccatcttgaaaaccacaaccaacgcactgagtaa
© 1998-2019