Dataset for CDS classical BH3-containing proteins of organism Aotus nancymaae

[Download (right click)] [Alignment] [Repertoires]

19 sequence(s)

>gnl|bcl2dbcds|A0A2K5BYA0_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Aotus nancymaae GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggtcgcggccccccggccgtttgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccagcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtatttttgaataattaccaagcagccgaagaccacccacacatggttatcttacg
actgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctgaa
cctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
gagggtatttttgaataattaccaagcagccgaagaccacccacacatggttatcttacgactgttacgttacattgtcc
gcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtatttttgaataattaccaagcagccgaagaccacccacacatggttatcttacg
actgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggatatctcttccatctgattga
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctgact
gggactag
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=297 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactgaatcctcccttgga
attgcccttcgtagggaggttcagtggccacttgagtggttagcaaaatcaagctga
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=318 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtgatatttcattgtggtttagattt
atatttaccttctttgatttgtatggccaccaccacagtcaaggtacagaacaactccaccacaagtatttctcatga
>gnl|bcl2dbcds|A0A2K5CFK7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Aotus nancymaae GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagagcgcgcaaccgagcccctcgcgggctccagcagaccttgaagtcgagtgtgccac
tcaactcaggagatttggagacaaactaaatttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2K5CLG5_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Aotus nancymaae GN=BIK (length=468 residues).
atgtctgaagttagacccctctccagtgacatcttgatggagaccctcttgtgtgagcagttcgtgcatcccctgaccat
ggaggttgtcggtgggagtgaccctgaagaggacctggaccctgtggaggaccctttggaatgcatggagaacagtgacg
cactggtcctgcagctggcctgcatcgcggaccagatggatgtgagccttagggcccggaggctggcccagctctatgag
gtggccatgtacagcccgggtctcgctttcatcctcgaccggaccgacatcggggatgttcttagcggtatcgtggaagt
tttcgctaacttccaggaggacatagtgaggctctggagatccctgagctccgggtcctgggtgtcccgcaaacaggcag
tgctgctggcactcctggcgctgctgctggcgatgttcagcgggggtctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K5E1W9_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Aotus nancymaae GN=BMF (length=390 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagtcagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttacgcatcagcagaaccgaaatcgcgtgtggt
ggcaggtcctcctctttctgcacaacctggctttgaatggagaagagaacaggaatggggcaggcccgag
>gnl|bcl2dbcds|A0A2K5E1W9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Aotus nancymaae GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagtcagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttacggcaatgctggctatcggcttcctctccc
tgccagtttcccagcagtcttgccccttggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacatcagcagaaccgaaatcgcgtgtgg
tggcaggtcctcctctttctgcacaacctggctttgaatggagaagagaacaggaatggggcaggcccgaggtga
>gnl|bcl2dbcds|A0A2K5E6K7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Aotus nancymaae GN=BAD (length=432 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctc
cagttggacgcaagtcatccagtcctggtgggatcggaacttgggcaggggaggctccgctccctcccagtgaccttcgc
tccacatcccgaaactccacccgttcccatcgccttgggcggccatcttggatatgggcggaagtgcttcctgcagggag
agctgacccagattcccttccggtgcgtgtga
>gnl|bcl2dbcds|A0A2K5E6K7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Aotus nancymaae GN=BAD (length=459 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggaggtgagtactccacttgtgcctctgcttcctcatctgagaatcccagtgcaagg
atgctctcgaaagcatcagcagggatgtccgccccagccactgactcagaaaatgtaaagctggaggtgccttgctgggt
cgccacagctcctaccccgcagggacggaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcg
ctcagcaccccccaacctctgggcagcacagcgctatggccgcgagctccggaggatga
>gnl|bcl2dbcds|A0A2K5E6K7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Aotus nancymaae GN=BAD (length=504 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggaggcgctggggctgtggagacccgaagtcgccacagctcctaccccgcagggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcgctcagcaccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcaacgcagatgcggcaaagctccagttggacgcaagtcatccagtcctggtgggatcggaacttgggcagg
ggaggctccgctccctcccagtga
>gnl|bcl2dbcds|A0A2K5F6X4_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Aotus nancymaae GN=BBC3 (length=393 residues).
aaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcctagggcttcttcctcgacgtgggtcccctgccagat
gtgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggcgg
gcggtcccacccaggcggccccgggagtccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcggcgg
atggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagccgcagcaccgcccctcaccctggagggt
cctgtacaatctcatcatgggactcctgccctttcccaggggccacagagcccccgagatggagcccaattag
© 1998-2018