Dataset for CDS BAD of organism Aotus nancymaae

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A2K5E6K7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Aotus nancymaae GN=BAD (length=504 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggaggcgctggggctgtggagacccgaagtcgccacagctcctaccccgcagggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcgctcagcaccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcaacgcagatgcggcaaagctccagttggacgcaagtcatccagtcctggtgggatcggaacttgggcagg
ggaggctccgctccctcccagtga
>gnl|bcl2dbcds|A0A2K5E6K7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Aotus nancymaae GN=BAD (length=432 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctc
cagttggacgcaagtcatccagtcctggtgggatcggaacttgggcaggggaggctccgctccctcccagtgaccttcgc
tccacatcccgaaactccacccgttcccatcgccttgggcggccatcttggatatgggcggaagtgcttcctgcagggag
agctgacccagattcccttccggtgcgtgtga
>gnl|bcl2dbcds|A0A2K5E6K7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Aotus nancymaae GN=BAD (length=459 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggaggtgagtactccacttgtgcctctgcttcctcatctgagaatcccagtgcaagg
atgctctcgaaagcatcagcagggatgtccgccccagccactgactcagaaaatgtaaagctggaggtgccttgctgggt
cgccacagctcctaccccgcagggacggaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcg
ctcagcaccccccaacctctgggcagcacagcgctatggccgcgagctccggaggatga
© 1998-2018