Dataset for CDS classical BH3-containing proteins of organism Anabas testudineus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A3Q1ICY2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L11 (length=726 residues).
atggatcctagacaaccaaaccgctccgatggctcgacagctgtaacggccacaggggagagcggaggagacccaccacc
cgtcggtgccgctggagtctcaacgccaacctcccgttcgaacgacggcggggagcggaggtttggccgccctgactcca
gtggaggaggagagcctgaatcgcagtcccggtgcagaaccaaaagtagctcgtcttccgacggcctaggcgtgtttagg
tcagtattccgcctcccccggcgctcctctagtggatatttctcctacgacagtgactcgcagccgagctccccgctctc
acctaggccagtgacgtttgacagagccacgcagactccgagccccaccggccaggtgatgaaccacgccctgcagcgct
tggccgaggcgaacggctcagacctgaggacgcatcagcagcacggaagcgatctcagctcctctagcacgcagcaacaa
aacgcagcaggggatatgcaggcagtggaagtcggacgagagctccgacgcattggagacgacttcaataaccacctcct
ggaggtggcaggcagacatagatgggtggggatccaaccaatccgattaccacatatccaccaggaccccactgtcctgc
tctgcgtgggcctcctgctctttgtgattggacggataatctactcgcaaggcagtacgaacagcgagggccactctcac
gtttag
>gnl|bcl2dbcds|A0A3Q1IPR4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Anabas testudineus GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccactgctggcgtaccacattcagggagataaagtgtcaaga
ccggggcacacagacacctggccctgcgctgccacagaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggcaacgcaggttttcggttgcacttcccagcacacttcgagcttgttggggatctggaagtgaggcaa
caagacagtgaggaggaacaaaacgggatggagatcccaccccggcaacaaccactgatgcaaagcgtggaagcctgtat
tggccagaaactccagctaataggagaccagtttcacagagaacacctacaactgtatcatcgaaaccaaaggaaccagg
gcccgctgtggtggcgcctggccgcagctatgctcagcctcctgtttgacaggggattaattgctggaggaggcggagca
ggacggaggtga
>gnl|bcl2dbcds|A0A3Q1K1C7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Anabas testudineus GN=BAD (length=498 residues).
atggcagcaagattcaccatttcagacagcgactcagacccatcagaggggatggaggaagaaggacacaaccagtcacc
accagggcaagagcagcaagtttttccacgccacacccttaccttaccggaactcagagctagtggtcgaatcaggctga
actcagagtctcacgcttccaccgtctacagagacgaagaactccaggccaaggcagatgaggaagctggtacgcccaca
gatggagctccattcagggcacggtccaagtctgctccaccagccctgtgggcagcaaagaaatacggccagcagctcag
aagaatgagtgacgagtttgacagcctgctagacaaaggggagatgaggaaggtgaggagcgctggcacggccagacaga
tgcaccactctaagagctggtggagctacctctttagtcaccaggagactgagggagagaacaatcaccacgaaagccac
acacaccgcactgagtag
>gnl|bcl2dbcds|A0A3Q1K1C7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Anabas testudineus GN=BAD (length=498 residues).
atggcagcaagattcaccatttcagacagcgactcagacccatcagaggggatggaggaagaaggacacaaccagtcacc
accagggcaagagcagcaagtttttccacgccacacccttaccttaccggaactcagagctagtggtcgaatcaggctga
actcagagtctcacgcttccaccgtctacagagacgaagaactccaggccaaggcagatgaggaagctggtacgcccaca
gatggagctccattcagggcacggtccaagtctgctccaccagccctgtgggcagcaaagaaatacggccagcagctcag
aagaatgagtgacgagtttgacagcctgctagacaaaggggagatgaggaaggtgaggagcgctggcacggccagacaga
tgcaccactctaagagctggtggagctacctctttagtcaccaggagactgagggagagaacaatcaccacgaaagccac
acacaccgcactgagtag
© 1998-2019