Dataset for CDS BCL2L11 of organism Anabas testudineus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q1ICY2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L11 (length=726 residues).
atggatcctagacaaccaaaccgctccgatggctcgacagctgtaacggccacaggggagagcggaggagacccaccacc
cgtcggtgccgctggagtctcaacgccaacctcccgttcgaacgacggcggggagcggaggtttggccgccctgactcca
gtggaggaggagagcctgaatcgcagtcccggtgcagaaccaaaagtagctcgtcttccgacggcctaggcgtgtttagg
tcagtattccgcctcccccggcgctcctctagtggatatttctcctacgacagtgactcgcagccgagctccccgctctc
acctaggccagtgacgtttgacagagccacgcagactccgagccccaccggccaggtgatgaaccacgccctgcagcgct
tggccgaggcgaacggctcagacctgaggacgcatcagcagcacggaagcgatctcagctcctctagcacgcagcaacaa
aacgcagcaggggatatgcaggcagtggaagtcggacgagagctccgacgcattggagacgacttcaataaccacctcct
ggaggtggcaggcagacatagatgggtggggatccaaccaatccgattaccacatatccaccaggaccccactgtcctgc
tctgcgtgggcctcctgctctttgtgattggacggataatctactcgcaaggcagtacgaacagcgagggccactctcac
gtttag
© 1998-2019