Dataset for CDS BAD of organism Anabas testudineus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q1K1C7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Anabas testudineus GN=BAD (length=498 residues).
atggcagcaagattcaccatttcagacagcgactcagacccatcagaggggatggaggaagaaggacacaaccagtcacc
accagggcaagagcagcaagtttttccacgccacacccttaccttaccggaactcagagctagtggtcgaatcaggctga
actcagagtctcacgcttccaccgtctacagagacgaagaactccaggccaaggcagatgaggaagctggtacgcccaca
gatggagctccattcagggcacggtccaagtctgctccaccagccctgtgggcagcaaagaaatacggccagcagctcag
aagaatgagtgacgagtttgacagcctgctagacaaaggggagatgaggaaggtgaggagcgctggcacggccagacaga
tgcaccactctaagagctggtggagctacctctttagtcaccaggagactgagggagagaacaatcaccacgaaagccac
acacaccgcactgagtag
>gnl|bcl2dbcds|A0A3Q1K1C7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Anabas testudineus GN=BAD (length=498 residues).
atggcagcaagattcaccatttcagacagcgactcagacccatcagaggggatggaggaagaaggacacaaccagtcacc
accagggcaagagcagcaagtttttccacgccacacccttaccttaccggaactcagagctagtggtcgaatcaggctga
actcagagtctcacgcttccaccgtctacagagacgaagaactccaggccaaggcagatgaggaagctggtacgcccaca
gatggagctccattcagggcacggtccaagtctgctccaccagccctgtgggcagcaaagaaatacggccagcagctcag
aagaatgagtgacgagtttgacagcctgctagacaaaggggagatgaggaaggtgaggagcgctggcacggccagacaga
tgcaccactctaagagctggtggagctacctctttagtcaccaggagactgagggagagaacaatcaccacgaaagccac
acacaccgcactgagtag
© 1998-2019