Dataset for CDS BAD of organism Amphiprion percula

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3P8TWH6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Amphiprion percula GN=BAD (length=504 residues).
atggctgcaaaattcactatttcagacagcgagtcagagccatcagaggaggtagaagagggagaaaacaaccattcacc
agcaacacaagccatgcctgttttcgcccgccgcaacatggccttacctgaactcagaactccagcatctggtcggctca
ggctgaactcggagtcccacgcctccacgctctccagagatgaggagctccaggcgaggggggaagaggaagccggcacg
cccacagacggagctccgttcagggcacggtccaagtcggctccccctgcactgtgggccgccaagaagtacggccagca
gcttcgaaggatgagcgatgagtttgacagcctgctagataaaggggagatgaagagggtgaggagtgcagggacagcca
gacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggagatggagggagagaacaaccaccatgaa
agccacacacatcgcaatgagtag
© 1998-2019