Dataset for CDS classical BH3-containing proteins of organism Amphiprion ocellaris

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A3Q1CI15_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L11 (length=549 residues).
cctacaaagtccggtcctgacgcagcagcgcgctgcttcaccagcggctccagatgcagagactcagagaggctaccgcc
aaatccgtcccatggctcgccggactccccgtcctggtccagagcgcaggccagcctaggcgtgtttcagaccaggtcga
tttttcacctccctcgccgctcctccagtggctatttctccgccgatggtgccgactcggtgccgagctccccgctctca
ccgaagcgactgacggctgacaaagccacgcagactccgagcccgagcggccaggtgatcaaacacgcgctggagcgcat
gaccgatgaggcgcacggaggaggaccgggaacgcagcagcacggtgagctcaggctgacatacacgagggaaatcagtt
gcacattcaatctctgcaatagtttttgcacgctgttttctgtcactgttttctgtcatcttcagtcgctgtttgcgtct
acgctacaaaacgtcttgattaggtttattaacccaaactacttcagtacattttggaacagatgttaa
>gnl|bcl2dbcds|A0A3Q1CPU7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Amphiprion ocellaris GN=BAD (length=504 residues).
atggctgcaaaattcactatttcagacagcgagtcagagccatcagaggaggtagaagagggagaaaacaaccattcacc
agcaacacaagccatgcctgttttcgcccgccgcaacatggccttacctgaactcagaactccagcatctggtcggctca
ggctgaactcggagtcccacgcctccacgctctccagagatgaggagctccaggcgaggggggaagaggaagccggcacg
cccacagacggagctccgttcagggcacggtccaagtcggctccccctgcactgtgggccgccaagaagtacggccagca
gcttcgaaggatgagcgatgagtttgacagcctgctagataaaggggagatgaagagggtgaggagtgcagggacagcca
gacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggagatggagggagagaacaaccaccatgaa
agccacacacatcgcaatgagtag
>gnl|bcl2dbcds|A0A3Q1D1K3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Amphiprion ocellaris GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtttttgagccagacccccactgctggcgcacaacattcagggagataaagtgtgaaga
ccggggcacacagactcctggtcctgccctgcaaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgactgcacttcccagcacgctttgagcttattgggaatcaccaagcgaggcaa
caaggaagtgaaatggagcaaaatgggatggagcagctgccccggcagcaacctgtggcacgcagcatggaggcttgcat
tggacagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaaccagg
ggccgctgtggtggcgcctggccgcagccgttctcagccttctgtttgacagggggttcattgctggaggaggtggtgca
ggacggaggtga
© 1998-2019