Dataset for CDS classical BH3-containing proteins of organism Amphilophus citrinellus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q0QNQ2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Amphilophus citrinellus GN=BAD (length=489 residues).
ttcatccattttcttccgtttatccagggtcgggggcagcagcctagccacctcctgcagctgatctggggaacaccaag
gcattcccaggccataggacatgaccagaacacttcacccatgaggcatcctactgccaggaggatcaggatgaactcag
agtcccacacttcctcagtctccagggatgaggagctcgtcgtcagaggggaggacgagatctgtactcccacagaggga
gatccattcaggcgaaggtcaaagtccgcaccccctgctctgtgggctgccaagaagtacggccagcagcttcgaaggat
gagtgatgagtttgacagcctactagataaagggatgaagaaggccaagaatgctgggaccaccagaaagatgcaccact
ctaaaacctggtggagctatctctttagtcaccaggagagtgatggagagaacagccatcatgaaaaccacacacaacgc
actgagtaa
>gnl|bcl2dbcds|A0A3Q0QNQ2_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Amphilophus citrinellus GN=BAD (length=432 residues).
atgcccgaaccacctcgactggttctttttgatgtagaagaaggacagtcacccttcagagaaggctcatttctactgct
tgtatctgtgatctcrttcttttggtcactacccaaagctttctccagggatgaggagctcgtcgtcagaggggaggacg
agatctgtactcccacagagggagatccattcaggcgaaggtcaaagtccgcaccccctgctctgtgggctgccaagaag
tacggccagcagcttcgaaggatgagtgatgagtttgacagcctactagataaagggatgaagaaggccaagaatgctgg
gaccaccagaaagatgcaccactctaaaacctggtggagctatctctttagtcaccaggagagtgatggagagaacagcc
atcatgaaaaccacacacaacgcactgagtaa
© 1998-2019