Dataset for CDS classical BH3-containing proteins of organism Acanthochromis polyacanthus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A3Q1ELG4_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL2L11 (length=543 residues).
agctccagcgctgcttcacccgcggctccacatgcagacactacagagggcggcggagcggatccagaacccgtcggtgc
agctggagtctcggcgaaaacatcccgttcgaactccaccggaggagagccggactccccgtcctggtccagagccagcc
taggcgtgtttcagaccaggtcgatatttcacctccctcgccgctcctccagtggttatttctccgccgatggttccgac
tcggtgccgagctccccgctctcaccgaagcggctgacggctgacaaaaccacgcaaactccgagcccgagcggccaggt
gatcagacacgcactggagcgcatggccggtgaggcgcacagaggaggaccggagacgcagcggcagcagcacggtgagc
tgaatgactgcaggagctgcggacaaaggaaaaccagtttgacattctctgcagtagtttttgctctcgccattgtctgt
ccttgtcttctgtcatttttgttcactgtttgctttcgtttctgcaacaaacgagttaaataa
>gnl|bcl2dbcds|A0A3Q1FVH7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BMF (length=480 residues).
atggacgatgaggaggatgatgtgtttgagccagacacccactgctggcgcacaacattcagggagataaagtgtgaaga
ccggggcacacagactcctggtcctgccctacaaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgactgcacttcccagcacactttgagcttattgcgaggcaacaaggaagtgaa
atggagcaaaatgggatggagcagctgccccggcagcaacctatggcacacagcgtggaggcttgcattggacagaaact
ccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaaccaggggccgctgtggt
ggcgcctggtcgcagccattctcagccttctgtttgacggggggttcattgctggaggaggtggtgcaggacggaggtga
>gnl|bcl2dbcds|A0A3Q1FVH7_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BMF (length=480 residues).
atggacgatgaggaggatgatgtgtttgagccagacacccactgctggcgcacaacattcagggagataaagtgtgaaga
ccggggcacacagactcctggtcctgccctacaaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgactgcacttcccagcacactttgagcttattgcgaggcaacaaggaagtgaa
atggagcaaaatgggatggagcagctgccccggcagcaacctatggcacacagcgtggaggcttgcattggacagaaact
ccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaaccaggggccgctgtggt
ggcgcctggtcgcagccattctcagccttctgtttgacggggggttcattgctggaggaggtggtgcaggacggaggtga
>gnl|bcl2dbcds|A0A3Q1GWH9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BAD (length=498 residues).
atggctgcaaaattctcaatttcagacggcgactcagagccagaggaagtggagggagaaaacaaccattcaccagcaac
agaagccatgcctgtcttcgcccgccgcaacatggccttacctgaactcagaaccccagcatctggtcggatcaggctga
actcggagtcccacgcctccacgctctccagagatgaggagctccaggcaaagggggaagaggaagccggcacgcccaca
gagggagctccgttcagggcacggtctaagtcggctccccctgcgctgtgggccgccaagaagtacggccagcagctccg
aaggatgagcgacgagtttgacagcctgctagacaaaggggagatgaagagagtgaggagcgcagggacggccagacaga
tgcaccactctaaaagctggtggagctacctctttagtcaccaggagatggagggagagaacaaccaccatgaaagccac
acacatcgcaatgagtag
© 1998-2019