Dataset for CDS poxviridae of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

20 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A385HA64_FPV039-      at-----------ggct----agtagtaatatgaaagacga---------
Q70HB1_FPV039-01        at-----------ggct----agtagtaatatgaaagacga---------
Q9J5G4_FPV039-01        at-----------ggct----agtagtaatatgaaagacga---------
Q6TV64_ORFV125-01       atgatcggtgacaggcatcgcgacgataccgacatcgacgccagcgccgt
F1AXH8_ORFV125-01       at-----------ggca----aacagagaagaaattgacgcctctgccgt
A0A0F6N236_ORFV125      at-----------ggca----aacagagaagagattgacgcttccgccgt
Q6TVX5_ORFV125-01       at-----------ggca----aacagagaagagattgacgcctccgccgt
Q80G30_ORFV125-01       at-----------ggca----aacagagaagagattgacgcctccgccgt
W6EVU4_ORFV125-01       at-----------ggca----aacagagaagagattgacgcctccgccgt
Q6TVJ5_ORFV125-01       at-----------ggca----aacagagacgacattgacgcctccgccgt
A0A2Z2Q9B0_ORFV125      at-----------ggca----aacagagacgacattgacgcctccgccgt
A0A1D8RAA0_ORFV125      at-----------ggca----aacagagaagagattgacgcctccgccgt
A0A2Z2QAK0_ORFV125      at-----------ggca----aacagagaagagattgacgcctccgccgt
A0A2Z2Q5R8_ORFV125      at-----------ggca----aacagagacgacattgacgcctccgccgt
A0A2Z2Q7G3_ORFV125      at-----------ggca----aacagagacgacattgacgcctccgccgt
A0A0R8I4U2_ORFV125      at-----------ggca----aacagagacgaaattgacgcctccgccgt
A0A0R8HLA0_ORFV125      at-----------ggca----aacagagacgacattgacgcctccgccgt
A0A0R8HV90_ORFV125      at-----------ggca----aacagagacgacattgacgcctccgccgt
D3IZD7_ORFV125-01       at-----------ggca----aacagaaacgaaatcgactcctccgccgt
D3IZF4_ORFV125-01       at-----------ggca----aacagaaacgacatcgactcctccgccgt
                        **           ***                 *  ***           

A0A385HA64_FPV039-      ---aacttattatatcgct-ttgaatatgatacagaactatatcatagaa
Q70HB1_FPV039-01        ---aacttattatatcgct-ttgaatatgatacagaactatatcatagaa
Q9J5G4_FPV039-01        ---aacttattatatcgct-ttgaatatgatacagaactatatcatagaa
Q6TV64_ORFV125-01       cgtgaccgcgtatctcgccagcgagtacgccaacg--cggtcatcgacaa
F1AXH8_ORFV125-01       catggctgcctacctcgcgagagagtacgcggtgg--ctgtagaggaaca
A0A0F6N236_ORFV125      catggctgcctacctcgcgagagagtacgcggcgg--cggtagaggaaca
Q6TVX5_ORFV125-01       catggctgcctacctcgcgagagagtacgcggcgg--ctgtagaagaaca
Q80G30_ORFV125-01       catggctgcctacctcgcgagagagtacgcggcgg--ctgtagaagaaca
W6EVU4_ORFV125-01       tatggctgcctacctcgcgagagagtacgcggagg--ctgtagaggaaca
Q6TVJ5_ORFV125-01       tatggctgcctacctcgcgagagagtacgcggagg--ctgtagaggaaca
A0A2Z2Q9B0_ORFV125      tatggctgcctacctcgcgagagagtacgcggagg--ctgtagaggaaca
A0A1D8RAA0_ORFV125      tatggctgcctacctcgcgagagagtacgcggagg--ctgtagaggaaca
A0A2Z2QAK0_ORFV125      catggctgcctacctcgcgagagagtacgcggagg--ctgtagaggaaca
A0A2Z2Q5R8_ORFV125      tatggctgcccacctcgcgagagagtacgcggagg--ctgtagaggaaca
A0A2Z2Q7G3_ORFV125      tatggctgcctacctcgcgagagagtacgcggagg--ctgtagaggaaca
A0A0R8I4U2_ORFV125      catggctgcctacctcgcgagagagtacgcggagg--ctgtagaggaaca
A0A0R8HLA0_ORFV125      tatggctgcctacctcgcgagagagtacgcggagg--ctgtagaggaaca
A0A0R8HV90_ORFV125      catggctgcctacctcgcgagagagtacgcggagg--ctgtagaggaaca
D3IZD7_ORFV125-01       cgtggccgcctacctcgcggggcagtacgcggccg--cggtagaggagca
D3IZF4_ORFV125-01       cgtggccgcctacctcgcggggcagtacgcggccg--cggtcgaggagca
                             *     *  ****     * ** *     *  *  *     *  *

A0A385HA64_FPV039-      tataacacaaataaaccaaga--------aaaagttttgtaat-------
Q70HB1_FPV039-01        tataacacaaataaaccaaga--------aaaagttttgtaat-------
Q9J5G4_FPV039-01        tataacacaaataaaccaaga--------aaaagttttgtaat-------
Q6TV64_ORFV125-01       cctttcggatgccgaacgcgtggcgctggaggcattgcgcgcctccggag
F1AXH8_ORFV125-01       gctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
A0A0F6N236_ORFV125      gctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
Q6TVX5_ORFV125-01       gctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
Q80G30_ORFV125-01       gctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
W6EVU4_ORFV125-01       gctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
Q6TVJ5_ORFV125-01       gctgacgctgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
A0A2Z2Q9B0_ORFV125      gctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
A0A1D8RAA0_ORFV125      gctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
A0A2Z2QAK0_ORFV125      gctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
A0A2Z2Q5R8_ORFV125      gctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
A0A2Z2Q7G3_ORFV125      gctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
A0A0R8I4U2_ORFV125      gctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
A0A0R8HLA0_ORFV125      gctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
A0A0R8HV90_ORFV125      gctgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcg
D3IZD7_ORFV125-01       gctgacgccgcgcgagcgcgaggcactcgaggcccttcgcatctccggcg
D3IZF4_ORFV125-01       gctgacgccgcgcgagcgcgaggcgctcgcggcccttcgcatctccggcg
                          *  *        * *  *               *  *           

A0A385HA64_FPV039-      ---agattctatatcctatgatgt--------tctaaaggcagcgtgtaa
Q70HB1_FPV039-01        ---agattctatatcctatgatgt--------tctaaaggcagcgtgtaa
Q9J5G4_FPV039-01        ---agattctatatcctatgatgt--------tctaaaggcagcgtgtaa
Q6TV64_ORFV125-01       acgaggtacgccaccccatgctgcaggagctgacaaacgccggcggcaat
F1AXH8_ORFV125-01       aggaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcac
A0A0F6N236_ORFV125      aggaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcac
Q6TVX5_ORFV125-01       aggaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcac
Q80G30_ORFV125-01       aggaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcac
W6EVU4_ORFV125-01       aggaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcac
Q6TVJ5_ORFV125-01       aggaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcac
A0A2Z2Q9B0_ORFV125      aggaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcac
A0A1D8RAA0_ORFV125      aggaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcac
A0A2Z2QAK0_ORFV125      aggaggtccggccgccgctgctgcaagaactctcgaacgcgggcgagcac
A0A2Z2Q5R8_ORFV125      aggaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcac
A0A2Z2Q7G3_ORFV125      aggaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcac
A0A0R8I4U2_ORFV125      aggaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcac
A0A0R8HLA0_ORFV125      aggaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcac
A0A0R8HV90_ORFV125      aggaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcac
D3IZD7_ORFV125-01       acgaggtccggtccccgctgctgcaggagctctccaacgccggcgactac
D3IZF4_ORFV125-01       acgaggtccggtccccgctgctgcgggagctctccaacgccggcgactac
                           ** * *     **  ** **          * ** *   ***   * 

A0A385HA64_FPV039-      atcagtaataaaaaccaattataatgaatttgatataattatatctagga
Q70HB1_FPV039-01        atcagtaataaaaaccaattataatgaatttgatataattatatctagga
Q9J5G4_FPV039-01        atcagtaataaaaaccaattataatgaatttgatataattatatctagga
Q6TV64_ORFV125-01       cac----------gcgaacccggagacctcgcacat-------tccggcc
F1AXH8_ORFV125-01       cgc----------gccaaccccgaaaactcgcacat-------ccccgcc
A0A0F6N236_ORFV125      cgc----------gccaaccccgaaaactcgcacat-------ccccgcc
Q6TVX5_ORFV125-01       cgc----------gccaaccccgaaaactcgcacat-------ccccgcc
Q80G30_ORFV125-01       cgc----------gccaaccccgaaaactcgcacat-------ccccgcc
W6EVU4_ORFV125-01       cgc----------gccaaccccgaaaactcgcacat-------ccccgcc
Q6TVJ5_ORFV125-01       cgc----------accaaccctgaaaactcgcacat-------ccccgcc
A0A2Z2Q9B0_ORFV125      cgc----------gccaaccccgaaaactcgcacat-------ccccgcc
A0A1D8RAA0_ORFV125      cgc----------gccaaccctgaaaactcgcacat-------tcccgcc
A0A2Z2QAK0_ORFV125      cgc----------gccaaccccgaaaactcgcacat-------ccccgcc
A0A2Z2Q5R8_ORFV125      cgc----------gccaaccccgaaaactcgcacat-------ccccgcc
A0A2Z2Q7G3_ORFV125      cgc----------gccaaccccgaaaactcgcacat-------ccccgcc
A0A0R8I4U2_ORFV125      cgc----------gccaaccccgaaaactcgcacat-------ccccgcc
A0A0R8HLA0_ORFV125      cgc----------gccaaccccgaaaactcgcacat-------ccccgcc
A0A0R8HV90_ORFV125      cgc----------gccaaccccgaaaactcgcacat-------ccccgcc
D3IZD7_ORFV125-01       cgc----------gcgaacccggagtcctcacacat-------ccccgcc
D3IZF4_ORFV125-01       cgc----------gcgaaccccgagaactcgcacat-------ccccgcc
                          *           * **     *    *   * **        *  *  

A0A385HA64_FPV039-      atattgattttaacgttatagtaacgcaagtattagaagataaaattaat
Q70HB1_FPV039-01        atattgattttaacgttatagtaacgcaagtattagaagataaaattaat
Q9J5G4_FPV039-01        atattgattttaacgttatagtaacgcaagtattagaagataaaattaat
Q6TV64_ORFV125-01       accctcatttcagcacta--------------cttgaagcaccagcctcc
F1AXH8_ORFV125-01       gccctcgtctccgcgctt--------------ctcgaagcccccacctcc
A0A0F6N236_ORFV125      gccctcgtatccgcgctt--------------ctcgaagcccccacctcc
Q6TVX5_ORFV125-01       gccctcgtctccgcgctt--------------ctcgaagcccccacttcc
Q80G30_ORFV125-01       gccctcgtctccgcgctt--------------ctcgaagcccccacctcc
W6EVU4_ORFV125-01       gccctcgtctccgcgctt--------------ctcgaagcccccacctcc
Q6TVJ5_ORFV125-01       gccctcgtctccgcgctt--------------ctcgaaacccccacatcc
A0A2Z2Q9B0_ORFV125      gccctcgtctccgcgctt--------------ctcgaggcccctacctcc
A0A1D8RAA0_ORFV125      gccctcgtctccgcgctt--------------ctcgaggcccccacctcc
A0A2Z2QAK0_ORFV125      gccctcgtctccgcgctt--------------ctcgaggcccctacctcc
A0A2Z2Q5R8_ORFV125      gccctcgtctccgcgctt--------------ctcgaagctcccacctcc
A0A2Z2Q7G3_ORFV125      gccctcgtctccgcgctt--------------ctcgaagctcccacctcc
A0A0R8I4U2_ORFV125      gccctcgtctccgcgctt--------------ctcgaagctcccacttcc
A0A0R8HLA0_ORFV125      gccctcgtctccgcgctt--------------ctcgaagcccccacctcc
A0A0R8HV90_ORFV125      gccctcgtctccgcgctt--------------ctcgaagctcccacctcc
D3IZD7_ORFV125-01       gccctcgtctccgcactg--------------cttgaagcccccacctcc
D3IZF4_ORFV125-01       gccctcgtctccgcgctg--------------ctcgaagcccccacctcc
                            *  * *   *  *                * **             

A0A385HA64_FPV039-      tggggtagaataataactattattgccttttgtgcatactattctaaaaa
Q70HB1_FPV039-01        tggggtagaataataactattattgccttttgtgcatactattctaaaaa
Q9J5G4_FPV039-01        tggggtagaataataactattattgccttttgtgcatactattctaaaaa
Q6TV64_ORFV125-01       cccggccgcatggtgacggccatcgagctctgcgcgca------------
F1AXH8_ORFV125-01       cccggccgcatggtcactgcgattgagctctgcgcgca------------
A0A0F6N236_ORFV125      cccggccgcatggtcactgcgattgagctctgcgcgca------------
Q6TVX5_ORFV125-01       cccggccgcatggtcactgcgattgagctctgcgcgca------------
Q80G30_ORFV125-01       cccggccgcatggtcactgcgattgagctctgcgcgca------------
W6EVU4_ORFV125-01       cccggccgcatggtcactgcggttgagctctgtgcgca------------
Q6TVJ5_ORFV125-01       cccggccgcatggtcactgcggttgagctctgcgcgca------------
A0A2Z2Q9B0_ORFV125      cccggccgcgtggtcactgcggttgggctctgtgcgca------------
A0A1D8RAA0_ORFV125      cccggccgcatggtcactgcggttgagctctgcgcgca------------
A0A2Z2QAK0_ORFV125      cccggccgcatggtcactgcggttgagctctgcgcgca------------
A0A2Z2Q5R8_ORFV125      cccggccgcatggtcactgcggttgagctctgtgcgca------------
A0A2Z2Q7G3_ORFV125      cccggccgcatggtcactgcggttgagctctgtgcgca------------
A0A0R8I4U2_ORFV125      cccggccgcatggtcactgcggttgagctctgcgcgca------------
A0A0R8HLA0_ORFV125      cccggccgcatggtcactgcggttgagctctgcgcgca------------
A0A0R8HV90_ORFV125      cccggccgcatggtcaccgcggttgagctctgcgcgca------------
D3IZD7_ORFV125-01       cccggccgcatggtcaccgcggtcgagctctgcgcgca------------
D3IZF4_ORFV125-01       cccggccgcatggtcaccgcggtcgagctctgcgcgca------------
                           **  *  *  * **     * *   * ** **  *            

A0A385HA64_FPV039-      agttaaacaagatacttcacctcagtactacgatggaataatatcagaag
Q70HB1_FPV039-01        agttaaacaagatacttcacctcagtactacgatggaataatatcagaag
Q9J5G4_FPV039-01        agttaaacaagatacttcacctcagtactacgatggaataatatcagaag
Q6TV64_ORFV125-01       -------------------------------gatgggccggcggtggacg
F1AXH8_ORFV125-01       -------------------------------gatgggccggctatggacg
A0A0F6N236_ORFV125      -------------------------------gatgggccgggtatggacg
Q6TVX5_ORFV125-01       -------------------------------gatgggccgggtatggacg
Q80G30_ORFV125-01       -------------------------------gatgggccgggtatggacg
W6EVU4_ORFV125-01       -------------------------------gatgggccggctatggacg
Q6TVJ5_ORFV125-01       -------------------------------gatgggccggctatggacg
A0A2Z2Q9B0_ORFV125      -------------------------------gatgggccgactatggacg
A0A1D8RAA0_ORFV125      -------------------------------gatgggccggctatggacg
A0A2Z2QAK0_ORFV125      -------------------------------gatgggccggctatggacg
A0A2Z2Q5R8_ORFV125      -------------------------------gatgggccggctatggacg
A0A2Z2Q7G3_ORFV125      -------------------------------gatgggccggctatggacg
A0A0R8I4U2_ORFV125      -------------------------------gatgggccgactatggacg
A0A0R8HLA0_ORFV125      -------------------------------gatgggccggctatggacg
A0A0R8HV90_ORFV125      -------------------------------gatgggccggctatggacg
D3IZD7_ORFV125-01       -------------------------------gatgggccgtctctggacg
D3IZF4_ORFV125-01       -------------------------------gatgggccgtctctggacg
                                                       *****          ** *

A0A385HA64_FPV039-      cgataactgatgccatactatctaa---atatagatcttg-----gttca
Q70HB1_FPV039-01        cgataactgatgccatactatctaa---atatagatcttg-----gttca
Q9J5G4_FPV039-01        cgataactgatgccatactatctaa---atatagatcttg-----gttca
Q6TV64_ORFV125-01       cg----ccggttccagttcctcaacttcatgcggctcgtacacgtcctcg
F1AXH8_ORFV125-01       cg----cggccacaagctcgttgacttcatgcggctcgtgtacgtgctcc
A0A0F6N236_ORFV125      cg----cggccgcaagctcgtcgacttcatgcggctcgtgtacgtgctcc
Q6TVX5_ORFV125-01       cg----cggccgccggctcgtcgacttcatgcggctcgtgtacgtgctcc
Q80G30_ORFV125-01       cg----cggccgccagctcgtcgaattcatgcggctcgtgtacgtgctcc
W6EVU4_ORFV125-01       cg----cggccgccagctcgttgacttcatgcggctcgtgtacgtgctcc
Q6TVJ5_ORFV125-01       cg----cggccgccagctcgtcgacttcatgcggctcgtgtacgtgctcc
A0A2Z2Q9B0_ORFV125      cg----cggccgccagctcgtcgacttcatgcggctcgtgtacgtgctcc
A0A1D8RAA0_ORFV125      cg----cggccgccagctcgttgacttcatgcggctcgtgtacgtgctcc
A0A2Z2QAK0_ORFV125      cg----cggccgccagctcgtcgacttcatgcggctcgtgtacgtgctcc
A0A2Z2Q5R8_ORFV125      cg----cggccgccagctcgtcgacttcatgcggctcgtgtacgtgctcc
A0A2Z2Q7G3_ORFV125      cg----cggccgccagctcgtcgacttcatgcggctcgtgtacgtgctcc
A0A0R8I4U2_ORFV125      cg----cggccgccagctcgtcgacttcatgcggctcgtgtacgtgctcc
A0A0R8HLA0_ORFV125      cg----cggccgccggctcgtcgacttcatgcggctcgtgtacgtgctcc
A0A0R8HV90_ORFV125      cg----cggccgccagctcgtcgacttcatgcggctcgtgtacgtgctcc
D3IZD7_ORFV125-01       cg----cggccgacggctcatcgacttcgtgcggctcgtacacgtgctct
D3IZF4_ORFV125-01       cg----cggccgccggctcatcgacttcatgcggctcgtgcacgtgctct
                        **    * *           *  *     *   * ** *        ** 

A0A385HA64_FPV039-      tagaccaag--------attattggaatggaatt---cgtatatataaaa
Q70HB1_FPV039-01        tagaccaag--------attattggaatggaatt---cgtatatataaaa
Q9J5G4_FPV039-01        tagaccaag--------attattggaatggaatt---cgtatatataaaa
Q6TV64_ORFV125-01       tggatcgcatgccgcctacggcctccgaggacctcgccgtctggctcgaa
F1AXH8_ORFV125-01       taaaccgtctgccgcccacggccgacgaggacctcagcgcctggctgcag
A0A0F6N236_ORFV125      tagaccgtctgccgcccacggctgacgaggacctcagcgcctggctgcag
Q6TVX5_ORFV125-01       tagaccgtctgccgcccacggccgacgaggacctcagcgcctggctgcag
Q80G30_ORFV125-01       tagaccgtctgccgcccacggccgacgaggacctcagcacctggctgcag
W6EVU4_ORFV125-01       tagaccgtctgccgcccacggccgacgaggacctcagcgcctggctgcag
Q6TVJ5_ORFV125-01       tagaccgtctgccgcccacagccgacgaggacctcggcgcctggctgcag
A0A2Z2Q9B0_ORFV125      tagaccgtctgccgcccacggccgacgaggacctcggcgcctggctgcag
A0A1D8RAA0_ORFV125      tagaccgtctgccgcccacggccgacgaggacctcggcgcctggctgcag
A0A2Z2QAK0_ORFV125      tagaccgtctgccgcccacggccgacgaggacctcggcgcctggctgcag
A0A2Z2Q5R8_ORFV125      tagaccgtctgccgcccacggccgacgaggacctcggcgcctggctgcag
A0A2Z2Q7G3_ORFV125      tagaccgtctgccgcccacggccgacgaggacctcggcgcctggctgcag
A0A0R8I4U2_ORFV125      tagaccgtctgccgcccacggccgacgaggacctcggcgcctggctgcag
A0A0R8HLA0_ORFV125      tagaccgtctgccgcccacggccgacgaggacctcggcgcctggctgcag
A0A0R8HV90_ORFV125      tagaccgtctgccgcccacggccgacgaggacctcggcgcctggctgcag
D3IZD7_ORFV125-01       tcgaccgcatgccgtccacggccaacgacgacctcgccgcctggctgcag
D3IZF4_ORFV125-01       tcgaccgcatgccgtccacggccaacgacgacctcgccgcctggctgcag
                        *  * *           *           **  *   *   *   *  * 

A0A385HA64_FPV039-      actatt---cgtatattttcaatacagcttcatattgtatttttacagcc
Q70HB1_FPV039-01        actatt---cgtatattttcaatacagcttcatattgtatttttacagcc
Q9J5G4_FPV039-01        actatt---cgtatattttcaatacagcttcatattgtatttttacagcc
Q6TV64_ORFV125-01       cgcgcagcgcgcgtccaggcgacgcgtcatc-------gcatgtcccgcg
F1AXH8_ORFV125-01       gccgtcgcgcgagtgcacggcacgcggcgcc-------gcctgcaccgcg
A0A0F6N236_ORFV125      gccgtcgcgcgcgtacacggcacgcggcgcc-------gcctgcaccgcg
Q6TVX5_ORFV125-01       gccgtcgcgcgcgtgcacggcacgcggcgcc-------gcctgcaccgcg
Q80G30_ORFV125-01       gccgtcgcgcgcgtgcacggcacgcggcgcc-------gcctgcaccgcg
W6EVU4_ORFV125-01       gccgtcgcgcgcgtgcacggcacgcggcgcc-------gcctgcaccgcg
Q6TVJ5_ORFV125-01       gccgtcgcgcgcgtgcacggcacgcggcgcc-------gcctgcaccgcg
A0A2Z2Q9B0_ORFV125      gccgtcgcgcgcgtgcacggcacgcggcgcc-------gcctgcaccgcg
A0A1D8RAA0_ORFV125      gccgtcgcgcgcgtgcacggcacgcggcgcc-------gcctgcaccgcg
A0A2Z2QAK0_ORFV125      gccgtcgcgcgcgtgcacggcacgcggcgcc-------gcctgcaccgcg
A0A2Z2Q5R8_ORFV125      gctgtcgcgcgcgtgcacggcacgcggcgcc-------gcctgcaccgcg
A0A2Z2Q7G3_ORFV125      gccgtcgcgcgcgtgcacggcacgcggcgcc-------gcctgcaccgca
A0A0R8I4U2_ORFV125      gccgtcgcgcgcgtgcacggcacgcggcgcc-------gcctgcaccgcg
A0A0R8HLA0_ORFV125      gccgtcgcgcgcgtgcacggcacgcggcgcc-------gcctgcaccgcg
A0A0R8HV90_ORFV125      gccgtcgcgcgcgtgcacggcacgcggcgcc-------gcctgcaccgcg
D3IZD7_ORFV125-01       accgtcgcgcgcgtgcaccggtcgcggcgct-------ggctgcaccgct
D3IZF4_ORFV125-01       accgtcgcgcgcgtgcaccggtcgcggcgct-------ggctgcaccgct
                                 **  *          *  *             *   * ** 

A0A385HA64_FPV039-      tcgttga--tcattgcttcactagcagtttttaaaata-tgttcctt---
Q70HB1_FPV039-01        tcgttga--tcattgcttcactagcagtttttaaaata-tgttcctt---
Q9J5G4_FPV039-01        tcgttga--tcattgcttcactagcagtttttaaaata-tgttcctt---
Q6TV64_ORFV125-01       tcgccggtctcggcatgttcctcgccggttgcggcattctgttcgttgga
F1AXH8_ORFV125-01       ttctcggcgtcggggccgtcgtggcaggcgtcggtatgctgctgctcggc
A0A0F6N236_ORFV125      ttctcggcgtcggggccgtcatggcaggcgtcggtatgctgctgctcggc
Q6TVX5_ORFV125-01       ttctcggcgtcggggccgtcatggcaggcgtcggtatgctgctgctcggc
Q80G30_ORFV125-01       ttctcggcgtcggggccgtcatggcaggcgtcggtatgctgctgctcggc
W6EVU4_ORFV125-01       ttctcggcgtcggggctgtcatggcaggcgtcggtatgctgctgctcggc
Q6TVJ5_ORFV125-01       ctctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggc
A0A2Z2Q9B0_ORFV125      ctctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggc
A0A1D8RAA0_ORFV125      ctctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggc
A0A2Z2QAK0_ORFV125      ctctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggc
A0A2Z2Q5R8_ORFV125      ctctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggc
A0A2Z2Q7G3_ORFV125      ctctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggc
A0A0R8I4U2_ORFV125      ctctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggc
A0A0R8HLA0_ORFV125      ctctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggc
A0A0R8HV90_ORFV125      ctctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggc
D3IZD7_ORFV125-01       ctataggcgtcggcaccgtaatggcgggcgtgggcctgctcttccttggc
D3IZF4_ORFV125-01       ctataggtgtcggtaccgtaatggcgggcgtgggcctgctgttcctcggc
                             *   *           * ** *         *  *  *  *    

A0A385HA64_FPV039-      --------------ttatatgtaa
Q70HB1_FPV039-01        --------------ttatatgtaa
Q9J5G4_FPV039-01        --------------ttatatgtaa
Q6TV64_ORFV125-01       gccagattcctccgtcg---gtga
F1AXH8_ORFV125-01       gtgcgcgtgttgcggcgcacataa
A0A0F6N236_ORFV125      gtgcgcgtgttgcggcgcacataa
Q6TVX5_ORFV125-01       gtgcgcgtgttgcggcgcacataa
Q80G30_ORFV125-01       gtgcgcgtgttgcggcgcacataa
W6EVU4_ORFV125-01       gtgcgcgtgttgcggcgcacataa
Q6TVJ5_ORFV125-01       gtgcgcgtgttgcggcgcacataa
A0A2Z2Q9B0_ORFV125      gtgcgcgtgttgcggcgcacataa
A0A1D8RAA0_ORFV125      gtgcgcgtgttgcggcgcacataa
A0A2Z2QAK0_ORFV125      gtgcgcgtgttgcggcgcacataa
A0A2Z2Q5R8_ORFV125      gtgcgcgtgttgcggcgcacataa
A0A2Z2Q7G3_ORFV125      gtgcgcgtgttgcggcgcacataa
A0A0R8I4U2_ORFV125      gtgcgcgtgttgcggcgcacataa
A0A0R8HLA0_ORFV125      gtgcgcgtgttgcggcgcacataa
A0A0R8HV90_ORFV125      gtgcgcgtgttgcggcgcacataa
D3IZD7_ORFV125-01       gtgcgcgtgctgcgtcgcacttaa
D3IZF4_ORFV125-01       gtgcgcgtgctgcgccgcacttaa
                                             * *

© 1998-2019