Dataset for CDS ORFV125 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

17 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q6TV64_ORFV125-01       atgatcggtgacaggcatcgcgacgataccgacatcgacgccagcgccgt
F1AXH8_ORFV125-01       at-----------ggca----aacagagaagaaattgacgcctctgccgt
A0A0F6N236_ORFV125      at-----------ggca----aacagagaagagattgacgcttccgccgt
Q6TVX5_ORFV125-01       at-----------ggca----aacagagaagagattgacgcctccgccgt
Q80G30_ORFV125-01       at-----------ggca----aacagagaagagattgacgcctccgccgt
W6EVU4_ORFV125-01       at-----------ggca----aacagagaagagattgacgcctccgccgt
Q6TVJ5_ORFV125-01       at-----------ggca----aacagagacgacattgacgcctccgccgt
A0A2Z2Q9B0_ORFV125      at-----------ggca----aacagagacgacattgacgcctccgccgt
A0A1D8RAA0_ORFV125      at-----------ggca----aacagagaagagattgacgcctccgccgt
A0A2Z2QAK0_ORFV125      at-----------ggca----aacagagaagagattgacgcctccgccgt
A0A2Z2Q5R8_ORFV125      at-----------ggca----aacagagacgacattgacgcctccgccgt
A0A2Z2Q7G3_ORFV125      at-----------ggca----aacagagacgacattgacgcctccgccgt
A0A0R8I4U2_ORFV125      at-----------ggca----aacagagacgaaattgacgcctccgccgt
A0A0R8HLA0_ORFV125      at-----------ggca----aacagagacgacattgacgcctccgccgt
A0A0R8HV90_ORFV125      at-----------ggca----aacagagacgacattgacgcctccgccgt
D3IZD7_ORFV125-01       at-----------ggca----aacagaaacgaaatcgactcctccgccgt
D3IZF4_ORFV125-01       at-----------ggca----aacagaaacgacatcgactcctccgccgt
                        **           ****     **      ** ** *** *    *****

Q6TV64_ORFV125-01       cgtgaccgcgtatctcgccagcgagtacgccaacgcggtcatcgacaacc
F1AXH8_ORFV125-01       catggctgcctacctcgcgagagagtacgcggtggctgtagaggaacagc
A0A0F6N236_ORFV125      catggctgcctacctcgcgagagagtacgcggcggcggtagaggaacagc
Q6TVX5_ORFV125-01       catggctgcctacctcgcgagagagtacgcggcggctgtagaagaacagc
Q80G30_ORFV125-01       catggctgcctacctcgcgagagagtacgcggcggctgtagaagaacagc
W6EVU4_ORFV125-01       tatggctgcctacctcgcgagagagtacgcggaggctgtagaggaacagc
Q6TVJ5_ORFV125-01       tatggctgcctacctcgcgagagagtacgcggaggctgtagaggaacagc
A0A2Z2Q9B0_ORFV125      tatggctgcctacctcgcgagagagtacgcggaggctgtagaggaacagc
A0A1D8RAA0_ORFV125      tatggctgcctacctcgcgagagagtacgcggaggctgtagaggaacagc
A0A2Z2QAK0_ORFV125      catggctgcctacctcgcgagagagtacgcggaggctgtagaggaacagc
A0A2Z2Q5R8_ORFV125      tatggctgcccacctcgcgagagagtacgcggaggctgtagaggaacagc
A0A2Z2Q7G3_ORFV125      tatggctgcctacctcgcgagagagtacgcggaggctgtagaggaacagc
A0A0R8I4U2_ORFV125      catggctgcctacctcgcgagagagtacgcggaggctgtagaggaacagc
A0A0R8HLA0_ORFV125      tatggctgcctacctcgcgagagagtacgcggaggctgtagaggaacagc
A0A0R8HV90_ORFV125      catggctgcctacctcgcgagagagtacgcggaggctgtagaggaacagc
D3IZD7_ORFV125-01       cgtggccgcctacctcgcggggcagtacgcggccgcggtagaggagcagc
D3IZF4_ORFV125-01       cgtggccgcctacctcgcggggcagtacgcggccgcggtcgaggagcagc
                          ** * **  * *****  *  *******    ** **    **  * *

Q6TV64_ORFV125-01       tttcggatgccgaacgcgtggcgctggaggcattgcgcgcctccggagac
F1AXH8_ORFV125-01       tgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
A0A0F6N236_ORFV125      tgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
Q6TVX5_ORFV125-01       tgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
Q80G30_ORFV125-01       tgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
W6EVU4_ORFV125-01       tgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
Q6TVJ5_ORFV125-01       tgacgctgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
A0A2Z2Q9B0_ORFV125      tgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
A0A1D8RAA0_ORFV125      tgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
A0A2Z2QAK0_ORFV125      tgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
A0A2Z2Q5R8_ORFV125      tgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
A0A2Z2Q7G3_ORFV125      tgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
A0A0R8I4U2_ORFV125      tgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
A0A0R8HLA0_ORFV125      tgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
A0A0R8HV90_ORFV125      tgacgccgcgcgagcgcgatgcgctcgaagcccttcgcgtttccggcgag
D3IZD7_ORFV125-01       tgacgccgcgcgagcgcgaggcactcgaggcccttcgcatctccggcgac
D3IZF4_ORFV125-01       tgacgccgcgcgagcgcgaggcgctcgcggcccttcgcatctccggcgac
                        *  **     *** ****  ** ** *  **  * ***   ***** ** 

Q6TV64_ORFV125-01       gaggtacgccaccccatgctgcaggagctgacaaacgccggcggcaatca
F1AXH8_ORFV125-01       gaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcaccg
A0A0F6N236_ORFV125      gaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcaccg
Q6TVX5_ORFV125-01       gaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcaccg
Q80G30_ORFV125-01       gaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcaccg
W6EVU4_ORFV125-01       gaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcaccg
Q6TVJ5_ORFV125-01       gaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcaccg
A0A2Z2Q9B0_ORFV125      gaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcaccg
A0A1D8RAA0_ORFV125      gaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcaccg
A0A2Z2QAK0_ORFV125      gaggtccggccgccgctgctgcaagaactctcgaacgcgggcgagcaccg
A0A2Z2Q5R8_ORFV125      gaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcaccg
A0A2Z2Q7G3_ORFV125      gaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcaccg
A0A0R8I4U2_ORFV125      gaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcaccg
A0A0R8HLA0_ORFV125      gaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcaccg
A0A0R8HV90_ORFV125      gaggtccggtcgccgctgctgcaagaactctcgaacgcgggcgagcaccg
D3IZD7_ORFV125-01       gaggtccggtccccgctgctgcaggagctctccaacgccggcgactaccg
D3IZF4_ORFV125-01       gaggtccggtccccgctgctgcgggagctctccaacgccggcgactaccg
                        ***** **    **  ******  ** **  * ***** ****   * * 

Q6TV64_ORFV125-01       cgcgaacccggagacctcgcacattccggccaccctcatttcagcactac
F1AXH8_ORFV125-01       cgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttc
A0A0F6N236_ORFV125      cgccaaccccgaaaactcgcacatccccgccgccctcgtatccgcgcttc
Q6TVX5_ORFV125-01       cgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttc
Q80G30_ORFV125-01       cgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttc
W6EVU4_ORFV125-01       cgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttc
Q6TVJ5_ORFV125-01       caccaaccctgaaaactcgcacatccccgccgccctcgtctccgcgcttc
A0A2Z2Q9B0_ORFV125      cgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttc
A0A1D8RAA0_ORFV125      cgccaaccctgaaaactcgcacattcccgccgccctcgtctccgcgcttc
A0A2Z2QAK0_ORFV125      cgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttc
A0A2Z2Q5R8_ORFV125      cgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttc
A0A2Z2Q7G3_ORFV125      cgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttc
A0A0R8I4U2_ORFV125      cgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttc
A0A0R8HLA0_ORFV125      cgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttc
A0A0R8HV90_ORFV125      cgccaaccccgaaaactcgcacatccccgccgccctcgtctccgcgcttc
D3IZD7_ORFV125-01       cgcgaacccggagtcctcacacatccccgccgccctcgtctccgcactgc
D3IZF4_ORFV125-01       cgcgaaccccgagaactcgcacatccccgccgccctcgtctccgcgctgc
                        * * ***** **   *** ***** ** *** ***** * ** ** ** *

Q6TV64_ORFV125-01       ttgaagcaccagcctcccccggccgcatggtgacggccatcgagctctgc
F1AXH8_ORFV125-01       tcgaagcccccacctcccccggccgcatggtcactgcgattgagctctgc
A0A0F6N236_ORFV125      tcgaagcccccacctcccccggccgcatggtcactgcgattgagctctgc
Q6TVX5_ORFV125-01       tcgaagcccccacttcccccggccgcatggtcactgcgattgagctctgc
Q80G30_ORFV125-01       tcgaagcccccacctcccccggccgcatggtcactgcgattgagctctgc
W6EVU4_ORFV125-01       tcgaagcccccacctcccccggccgcatggtcactgcggttgagctctgt
Q6TVJ5_ORFV125-01       tcgaaacccccacatcccccggccgcatggtcactgcggttgagctctgc
A0A2Z2Q9B0_ORFV125      tcgaggcccctacctcccccggccgcgtggtcactgcggttgggctctgt
A0A1D8RAA0_ORFV125      tcgaggcccccacctcccccggccgcatggtcactgcggttgagctctgc
A0A2Z2QAK0_ORFV125      tcgaggcccctacctcccccggccgcatggtcactgcggttgagctctgc
A0A2Z2Q5R8_ORFV125      tcgaagctcccacctcccccggccgcatggtcactgcggttgagctctgt
A0A2Z2Q7G3_ORFV125      tcgaagctcccacctcccccggccgcatggtcactgcggttgagctctgt
A0A0R8I4U2_ORFV125      tcgaagctcccacttcccccggccgcatggtcactgcggttgagctctgc
A0A0R8HLA0_ORFV125      tcgaagcccccacctcccccggccgcatggtcactgcggttgagctctgc
A0A0R8HV90_ORFV125      tcgaagctcccacctcccccggccgcatggtcaccgcggttgagctctgc
D3IZD7_ORFV125-01       ttgaagcccccacctcccccggccgcatggtcaccgcggtcgagctctgc
D3IZF4_ORFV125-01       tcgaagcccccacctcccccggccgcatggtcaccgcggtcgagctctgc
                        * **  * **  * ************ **** ** **  * * ****** 

Q6TV64_ORFV125-01       gcgcagatgggccggcggtggacgcgccggttccagttcctcaacttcat
F1AXH8_ORFV125-01       gcgcagatgggccggctatggacgcgcggccacaagctcgttgacttcat
A0A0F6N236_ORFV125      gcgcagatgggccgggtatggacgcgcggccgcaagctcgtcgacttcat
Q6TVX5_ORFV125-01       gcgcagatgggccgggtatggacgcgcggccgccggctcgtcgacttcat
Q80G30_ORFV125-01       gcgcagatgggccgggtatggacgcgcggccgccagctcgtcgaattcat
W6EVU4_ORFV125-01       gcgcagatgggccggctatggacgcgcggccgccagctcgttgacttcat
Q6TVJ5_ORFV125-01       gcgcagatgggccggctatggacgcgcggccgccagctcgtcgacttcat
A0A2Z2Q9B0_ORFV125      gcgcagatgggccgactatggacgcgcggccgccagctcgtcgacttcat
A0A1D8RAA0_ORFV125      gcgcagatgggccggctatggacgcgcggccgccagctcgttgacttcat
A0A2Z2QAK0_ORFV125      gcgcagatgggccggctatggacgcgcggccgccagctcgtcgacttcat
A0A2Z2Q5R8_ORFV125      gcgcagatgggccggctatggacgcgcggccgccagctcgtcgacttcat
A0A2Z2Q7G3_ORFV125      gcgcagatgggccggctatggacgcgcggccgccagctcgtcgacttcat
A0A0R8I4U2_ORFV125      gcgcagatgggccgactatggacgcgcggccgccagctcgtcgacttcat
A0A0R8HLA0_ORFV125      gcgcagatgggccggctatggacgcgcggccgccggctcgtcgacttcat
A0A0R8HV90_ORFV125      gcgcagatgggccggctatggacgcgcggccgccagctcgtcgacttcat
D3IZD7_ORFV125-01       gcgcagatgggccgtctctggacgcgcggccgacggctcatcgacttcgt
D3IZF4_ORFV125-01       gcgcagatgggccgtctctggacgcgcggccgccggctcatcgacttcat
                        **************    ********* *      * ** *  * *** *

Q6TV64_ORFV125-01       gcggctcgtacacgtcctcgtggatcgcatgccgcctacggcctccgagg
F1AXH8_ORFV125-01       gcggctcgtgtacgtgctcctaaaccgtctgccgcccacggccgacgagg
A0A0F6N236_ORFV125      gcggctcgtgtacgtgctcctagaccgtctgccgcccacggctgacgagg
Q6TVX5_ORFV125-01       gcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgagg
Q80G30_ORFV125-01       gcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgagg
W6EVU4_ORFV125-01       gcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgagg
Q6TVJ5_ORFV125-01       gcggctcgtgtacgtgctcctagaccgtctgccgcccacagccgacgagg
A0A2Z2Q9B0_ORFV125      gcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgagg
A0A1D8RAA0_ORFV125      gcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgagg
A0A2Z2QAK0_ORFV125      gcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgagg
A0A2Z2Q5R8_ORFV125      gcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgagg
A0A2Z2Q7G3_ORFV125      gcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgagg
A0A0R8I4U2_ORFV125      gcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgagg
A0A0R8HLA0_ORFV125      gcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgagg
A0A0R8HV90_ORFV125      gcggctcgtgtacgtgctcctagaccgtctgccgcccacggccgacgagg
D3IZD7_ORFV125-01       gcggctcgtacacgtgctcttcgaccgcatgccgtccacggccaacgacg
D3IZF4_ORFV125-01       gcggctcgtgcacgtgctcttcgaccgcatgccgtccacggccaacgacg
                        *********  **** *** *  * **  ***** * ** **   *** *

Q6TV64_ORFV125-01       acctcgccgtctggctcgaacgcgcagcgcgcgtccaggcgacgcgtcat
F1AXH8_ORFV125-01       acctcagcgcctggctgcaggccgtcgcgcgagtgcacggcacgcggcgc
A0A0F6N236_ORFV125      acctcagcgcctggctgcaggccgtcgcgcgcgtacacggcacgcggcgc
Q6TVX5_ORFV125-01       acctcagcgcctggctgcaggccgtcgcgcgcgtgcacggcacgcggcgc
Q80G30_ORFV125-01       acctcagcacctggctgcaggccgtcgcgcgcgtgcacggcacgcggcgc
W6EVU4_ORFV125-01       acctcagcgcctggctgcaggccgtcgcgcgcgtgcacggcacgcggcgc
Q6TVJ5_ORFV125-01       acctcggcgcctggctgcaggccgtcgcgcgcgtgcacggcacgcggcgc
A0A2Z2Q9B0_ORFV125      acctcggcgcctggctgcaggccgtcgcgcgcgtgcacggcacgcggcgc
A0A1D8RAA0_ORFV125      acctcggcgcctggctgcaggccgtcgcgcgcgtgcacggcacgcggcgc
A0A2Z2QAK0_ORFV125      acctcggcgcctggctgcaggccgtcgcgcgcgtgcacggcacgcggcgc
A0A2Z2Q5R8_ORFV125      acctcggcgcctggctgcaggctgtcgcgcgcgtgcacggcacgcggcgc
A0A2Z2Q7G3_ORFV125      acctcggcgcctggctgcaggccgtcgcgcgcgtgcacggcacgcggcgc
A0A0R8I4U2_ORFV125      acctcggcgcctggctgcaggccgtcgcgcgcgtgcacggcacgcggcgc
A0A0R8HLA0_ORFV125      acctcggcgcctggctgcaggccgtcgcgcgcgtgcacggcacgcggcgc
A0A0R8HV90_ORFV125      acctcggcgcctggctgcaggccgtcgcgcgcgtgcacggcacgcggcgc
D3IZD7_ORFV125-01       acctcgccgcctggctgcagaccgtcgcgcgcgtgcaccggtcgcggcgc
D3IZF4_ORFV125-01       acctcgccgcctggctgcagaccgtcgcgcgcgtgcaccggtcgcggcgc
                        *****  *  ******  *    *  ***** ** **     **** *  

Q6TV64_ORFV125-01       cgcatgtcccgcgtcgccggtctcggcatgttcctcgccggttgcggcat
F1AXH8_ORFV125-01       cgcctgcaccgcgttctcggcgtcggggccgtcgtggcaggcgtcggtat
A0A0F6N236_ORFV125      cgcctgcaccgcgttctcggcgtcggggccgtcatggcaggcgtcggtat
Q6TVX5_ORFV125-01       cgcctgcaccgcgttctcggcgtcggggccgtcatggcaggcgtcggtat
Q80G30_ORFV125-01       cgcctgcaccgcgttctcggcgtcggggccgtcatggcaggcgtcggtat
W6EVU4_ORFV125-01       cgcctgcaccgcgttctcggcgtcggggctgtcatggcaggcgtcggtat
Q6TVJ5_ORFV125-01       cgcctgcaccgcgctctcggcgttggggccgtcgtggcaggcgtcggtat
A0A2Z2Q9B0_ORFV125      cgcctgcaccgcgctctcggcgttggggccgtcgtggcaggcgtcggtat
A0A1D8RAA0_ORFV125      cgcctgcaccgcgctctcggcgttggggccgtcgtggcaggcgtcggtat
A0A2Z2QAK0_ORFV125      cgcctgcaccgcgctctcggcgttggggccgtcgtggcaggcgtcggtat
A0A2Z2Q5R8_ORFV125      cgcctgcaccgcgctctcggcgttggggccgtcgtggcaggcgtcggtat
A0A2Z2Q7G3_ORFV125      cgcctgcaccgcactctcggcgttggggccgtcgtggcaggcgtcggtat
A0A0R8I4U2_ORFV125      cgcctgcaccgcgctctcggcgttggggccgtcgtggcaggcgtcggtat
A0A0R8HLA0_ORFV125      cgcctgcaccgcgctctcggcgttggggccgtcgtggcaggcgtcggtat
A0A0R8HV90_ORFV125      cgcctgcaccgcgctctcggcgttggggccgtcgtggcaggcgtcggtat
D3IZD7_ORFV125-01       tggctgcaccgctctataggcgtcggcaccgtaatggcgggcgtgggcct
D3IZF4_ORFV125-01       tggctgcaccgctctataggtgtcggtaccgtaatggcgggcgtgggcct
                         *  **  ****      **  * **     *  * ** **    **  *

Q6TV64_ORFV125-01       tctgttcgttggagccagattcctccgtcg---gtga
F1AXH8_ORFV125-01       gctgctgctcggcgtgcgcgtgttgcggcgcacataa
A0A0F6N236_ORFV125      gctgctgctcggcgtgcgcgtgttgcggcgcacataa
Q6TVX5_ORFV125-01       gctgctgctcggcgtgcgcgtgttgcggcgcacataa
Q80G30_ORFV125-01       gctgctgctcggcgtgcgcgtgttgcggcgcacataa
W6EVU4_ORFV125-01       gctgctgctcggcgtgcgcgtgttgcggcgcacataa
Q6TVJ5_ORFV125-01       gctgctgctcggcgtgcgcgtgttgcggcgcacataa
A0A2Z2Q9B0_ORFV125      gctgctgctcggcgtgcgcgtgttgcggcgcacataa
A0A1D8RAA0_ORFV125      gctgctgctcggcgtgcgcgtgttgcggcgcacataa
A0A2Z2QAK0_ORFV125      gctgctgctcggcgtgcgcgtgttgcggcgcacataa
A0A2Z2Q5R8_ORFV125      gctgctgctcggcgtgcgcgtgttgcggcgcacataa
A0A2Z2Q7G3_ORFV125      gctgctgctcggcgtgcgcgtgttgcggcgcacataa
A0A0R8I4U2_ORFV125      gctgctgctcggcgtgcgcgtgttgcggcgcacataa
A0A0R8HLA0_ORFV125      gctgctgctcggcgtgcgcgtgttgcggcgcacataa
A0A0R8HV90_ORFV125      gctgctgctcggcgtgcgcgtgttgcggcgcacataa
D3IZD7_ORFV125-01       gctcttccttggcgtgcgcgtgctgcgtcgcacttaa
D3IZF4_ORFV125-01       gctgttcctcggcgtgcgcgtgctgcgccgcacttaa
                         **  *  * ** *   *  *  * ** **    * *

© 1998-2018