Dataset for CDS FPV039 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q70HB1_FPV039-01      atggctagtagtaatatgaaagacgaaacttattatatcgctttgaatat
Q9J5G4_FPV039-01      atggctagtagtaatatgaaagacgaaacttattatatcgctttgaatat
                      **************************************************

Q70HB1_FPV039-01      gatacagaactatatcatagaatataacacaaataaaccaagaaaaagtt
Q9J5G4_FPV039-01      gatacagaactatatcatagaatataacacaaataaaccaagaaaaagtt
                      **************************************************

Q70HB1_FPV039-01      ttgtaatagattctatatcctatgatgttctaaaggcagcgtgtaaatca
Q9J5G4_FPV039-01      ttgtaatagattctatatcctatgatgttctaaaggcagcgtgtaaatca
                      **************************************************

Q70HB1_FPV039-01      gtaataaaaaccaattataatgaatttgatataattatatctaggaatat
Q9J5G4_FPV039-01      gtaataaaaaccaattataatgaatttgatataattatatctaggaatat
                      **************************************************

Q70HB1_FPV039-01      tgattttaacgttatagtaacgcaagtattagaagataaaattaattggg
Q9J5G4_FPV039-01      tgattttaacgttatagtaacgcaagtattagaagataaaattaattggg
                      **************************************************

Q70HB1_FPV039-01      gtagaataataactattattgccttttgtgcatactattctaaaaaagtt
Q9J5G4_FPV039-01      gtagaataataactattattgccttttgtgcatactattctaaaaaagtt
                      **************************************************

Q70HB1_FPV039-01      aaacaagatacttcacctcagtactacgatggaataatatcagaagcgat
Q9J5G4_FPV039-01      aaacaagatacttcacctcagtactacgatggaataatatcagaagcgat
                      **************************************************

Q70HB1_FPV039-01      aactgatgccatactatctaaatatagatcttggttcatagaccaagatt
Q9J5G4_FPV039-01      aactgatgccatactatctaaatatagatcttggttcatagaccaagatt
                      **************************************************

Q70HB1_FPV039-01      attggaatggaattcgtatatataaaaactattcgtatattttcaataca
Q9J5G4_FPV039-01      attggaatggaattcgtatatataaaaactattcgtatattttcaataca
                      **************************************************

Q70HB1_FPV039-01      gcttcatattgtatttttacagcctcgttgatcattgcttcactagcagt
Q9J5G4_FPV039-01      gcttcatattgtatttttacagcctcgttgatcattgcttcactagcagt
                      **************************************************

Q70HB1_FPV039-01      ttttaaaatatgttccttttatatgtaa
Q9J5G4_FPV039-01      ttttaaaatatgttccttttatatgtaa
                      ****************************

© 1998-2018