Dataset for CDS FPV039 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A385HA64_FPV039-      atggctagtagtaatatgaaagacgaaacttattatatcgctttgaatat
Q70HB1_FPV039-01        atggctagtagtaatatgaaagacgaaacttattatatcgctttgaatat
Q9J5G4_FPV039-01        atggctagtagtaatatgaaagacgaaacttattatatcgctttgaatat

A0A385HA64_FPV039-      gatacagaactatatcatagaatataacacaaataaaccaagaaaaagtt
Q70HB1_FPV039-01        gatacagaactatatcatagaatataacacaaataaaccaagaaaaagtt
Q9J5G4_FPV039-01        gatacagaactatatcatagaatataacacaaataaaccaagaaaaagtt

A0A385HA64_FPV039-      ttgtaatagattctatatcctatgatgttctaaaggcagcgtgtaaatca
Q70HB1_FPV039-01        ttgtaatagattctatatcctatgatgttctaaaggcagcgtgtaaatca
Q9J5G4_FPV039-01        ttgtaatagattctatatcctatgatgttctaaaggcagcgtgtaaatca

A0A385HA64_FPV039-      gtaataaaaaccaattataatgaatttgatataattatatctaggaatat
Q70HB1_FPV039-01        gtaataaaaaccaattataatgaatttgatataattatatctaggaatat
Q9J5G4_FPV039-01        gtaataaaaaccaattataatgaatttgatataattatatctaggaatat

A0A385HA64_FPV039-      tgattttaacgttatagtaacgcaagtattagaagataaaattaattggg
Q70HB1_FPV039-01        tgattttaacgttatagtaacgcaagtattagaagataaaattaattggg
Q9J5G4_FPV039-01        tgattttaacgttatagtaacgcaagtattagaagataaaattaattggg

A0A385HA64_FPV039-      gtagaataataactattattgccttttgtgcatactattctaaaaaagtt
Q70HB1_FPV039-01        gtagaataataactattattgccttttgtgcatactattctaaaaaagtt
Q9J5G4_FPV039-01        gtagaataataactattattgccttttgtgcatactattctaaaaaagtt

A0A385HA64_FPV039-      aaacaagatacttcacctcagtactacgatggaataatatcagaagcgat
Q70HB1_FPV039-01        aaacaagatacttcacctcagtactacgatggaataatatcagaagcgat
Q9J5G4_FPV039-01        aaacaagatacttcacctcagtactacgatggaataatatcagaagcgat

A0A385HA64_FPV039-      aactgatgccatactatctaaatatagatcttggttcatagaccaagatt
Q70HB1_FPV039-01        aactgatgccatactatctaaatatagatcttggttcatagaccaagatt
Q9J5G4_FPV039-01        aactgatgccatactatctaaatatagatcttggttcatagaccaagatt

A0A385HA64_FPV039-      attggaatggaattcgtatatataaaaactattcgtatattttcaataca
Q70HB1_FPV039-01        attggaatggaattcgtatatataaaaactattcgtatattttcaataca
Q9J5G4_FPV039-01        attggaatggaattcgtatatataaaaactattcgtatattttcaataca

A0A385HA64_FPV039-      gcttcatattgtatttttacagcctcgttgatcattgcttcactagcagt
Q70HB1_FPV039-01        gcttcatattgtatttttacagcctcgttgatcattgcttcactagcagt
Q9J5G4_FPV039-01        gcttcatattgtatttttacagcctcgttgatcattgcttcactagcagt

A0A385HA64_FPV039-      ttttaaaatatgttccttttatatgtaa
Q70HB1_FPV039-01        ttttaaaatatgttccttttatatgtaa
Q9J5G4_FPV039-01        ttttaaaatatgttccttttatatgtaa

© 1998-2019