Dataset for CDS 097R of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

29 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A0U2QBA9_097R-01      atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0U2QHX4_097R-01      atggacgtgaggcaatttctgttagactgcgaagctcccgaggagatggt
Q6YH32_097R-01          atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0U2R7T3_097R-01      atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
Q2WEP2_097R-01          atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
I2BFW4_097R-01          atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
D3TTY2_097R-01          atgggcgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A0D3R3I2_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
H6WEE3_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A192GQ13_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A223PJ87_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
Q6GZM8_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
H9XFR8_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
W8TMV3_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A2U9QGY4_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A2U9QHH2_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A220IH18_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A2P1GJP0_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
C3RWV2_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A222NTZ1_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A1B2ITU5_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0A0VDG1_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A2D0XKG8_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A223PJJ8_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0D3R3S5_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A222NTN8_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
T2C510_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
V5N073_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A2D0XMC5_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
                        ****  **************** ****** ********************

A0A0U2QBA9_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacatggcctgtg
A0A0U2QHX4_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacatggcctgtg
Q6YH32_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacatggcctgtg
A0A0U2R7T3_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacatggcctgtg
Q2WEP2_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggccttcg
I2BFW4_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
D3TTY2_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A0D3R3I2_097R-01      ggccctgagggccgccgcggacgccgtggggatagacaacagggcctgcg
H6WEE3_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A192GQ13_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacaaggcctgcg
A0A223PJ87_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
Q6GZM8_097R-01          ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
H9XFR8_097R-01          ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
W8TMV3_097R-01          ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
A0A2U9QGY4_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
A0A2U9QHH2_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
A0A220IH18_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
A0A2P1GJP0_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
C3RWV2_097R-01          ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
A0A222NTZ1_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A1B2ITU5_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A0A0VDG1_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcatgcg
A0A2D0XKG8_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcatgcg
A0A223PJJ8_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgca
A0A0D3R3S5_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A222NTN8_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
T2C510_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
V5N073_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A2D0XMC5_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
                        ******************************  ********* *** *   

A0A0U2QBA9_097R-01      cccacctgtacaccatgctgtgggaaggcatcaacctggaggaggttcac
A0A0U2QHX4_097R-01      cccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcac
Q6YH32_097R-01          cccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A0U2R7T3_097R-01      cccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcac
Q2WEP2_097R-01          cccacctatacaccatgctgtgggaaggcgttaacctggaggaggttcac
I2BFW4_097R-01          cccacctgtacaccatgctgtgggaaggcgtcaacctggaggatgttcac
D3TTY2_097R-01          cccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A0D3R3I2_097R-01      cccacctatacaccatgctgtgggaaggtgtcaacctggaggaggttcac
H6WEE3_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A192GQ13_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A223PJ87_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
Q6GZM8_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
H9XFR8_097R-01          cccacctatacaccatgctgtgggaaggcgtcagcctggaggaggttcac
W8TMV3_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A2U9QGY4_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A2U9QHH2_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A220IH18_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A2P1GJP0_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
C3RWV2_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A222NTZ1_097R-01      cccacctatacaccatgttgtgggaaggtgtcaacctggaggaggttcac
A0A1B2ITU5_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A0A0VDG1_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A2D0XKG8_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A223PJJ8_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A0D3R3S5_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggtgcac
A0A222NTN8_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
T2C510_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
V5N073_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A2D0XMC5_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
                        ******* ********* **********  * * ********* ** ***

A0A0U2QBA9_097R-01      gcatccttcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A0U2QHX4_097R-01      gcatccttcctgggagacggcgttgtaaactggggcagggtggccgcgtt
Q6YH32_097R-01          gcatccttcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A0U2R7T3_097R-01      gcatccttcctgggagacggcgttgtaaactggggcagggtggccgcgtt
Q2WEP2_097R-01          gcatccctcctgagagacggcgttgtaaactggggcagggtggccgcgtt
I2BFW4_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
D3TTY2_097R-01          gcatccctcctgggagacggcattgtaaactggggcagggtggccgcgtt
A0A0D3R3I2_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
H6WEE3_097R-01          gcatccctcctgggagacggcgttgtaaactggggcaggatggccgcgtt
A0A192GQ13_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgtgtt
A0A223PJ87_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
Q6GZM8_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
H9XFR8_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
W8TMV3_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A2U9QGY4_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A2U9QHH2_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A220IH18_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A2P1GJP0_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
C3RWV2_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A222NTZ1_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A1B2ITU5_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A0A0VDG1_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A2D0XKG8_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A223PJJ8_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A0D3R3S5_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A222NTN8_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
T2C510_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
V5N073_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A2D0XMC5_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
                        ****** ***** ******** ***************** ****** ***

A0A0U2QBA9_097R-01      tatgcacatctgcaggtacaccgtcaggacctttccgtctagcatggata
A0A0U2QHX4_097R-01      tatgcacatctgcaggtacaccgtcaggacctttccgtctagcatggata
Q6YH32_097R-01          tatgcacatctgcaggtacaccgtcaggacctttccgtctagcatggata
A0A0U2R7T3_097R-01      tatgcacatctgcaggtacaccgtcaggacctttccgtctagcatggata
Q2WEP2_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
I2BFW4_097R-01          tatgcacgtctgcaggtataccgtcaggacctttccgtctagcatggata
D3TTY2_097R-01          tatgcacatctgcaggtacaccgtcaggacctttccatctagcatggata
A0A0D3R3I2_097R-01      tatgcacatctgcaggtacattgtcaggacctttccgtctagcatggata
H6WEE3_097R-01          tatgcacatctgcagatacatcgtcaggacctttccgtctagcatggata
A0A192GQ13_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A223PJ87_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
Q6GZM8_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
H9XFR8_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
W8TMV3_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A2U9QGY4_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A2U9QHH2_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A220IH18_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A2P1GJP0_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
C3RWV2_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A222NTZ1_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A1B2ITU5_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A0A0VDG1_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A2D0XKG8_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A223PJJ8_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A0D3R3S5_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A222NTN8_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
T2C510_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
V5N073_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A2D0XMC5_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
                        ******* ******* ** *  ************** ** **********

A0A0U2QBA9_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatatacaag
A0A0U2QHX4_097R-01      ggacagaggttgctttgactaaatttatacaggacccaaagatatacaag
Q6YH32_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatatacaag
A0A0U2R7T3_097R-01      ggacagaggttgctttgactaaatttatacaggacccaaagatatacaag
Q2WEP2_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
I2BFW4_097R-01          ggacagaggttgctctgactaaatttatacaggacccaagggtagacaag
D3TTY2_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacgag
A0A0D3R3I2_097R-01      ggacagaggttgcgctaactaaatttatacaggacccaaagatagacaag
H6WEE3_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A192GQ13_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A223PJ87_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
Q6GZM8_097R-01          gaacagaggttgctctgactaaatttatacaggacccaaagatagacaag
H9XFR8_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
W8TMV3_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A2U9QGY4_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A2U9QHH2_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A220IH18_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A2P1GJP0_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
C3RWV2_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A222NTZ1_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A1B2ITU5_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A0A0VDG1_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A2D0XKG8_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A223PJJ8_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A0D3R3S5_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A222NTN8_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
T2C510_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
V5N073_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A2D0XMC5_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
                        * ***********  * ********************** * ** ** **

A0A0U2QBA9_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A0U2QHX4_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
Q6YH32_097R-01          cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A0U2R7T3_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
Q2WEP2_097R-01          caactcagagagtggacagataggctgggtacagttggggtgattgggaa
I2BFW4_097R-01          cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
D3TTY2_097R-01          cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A0D3R3I2_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
H6WEE3_097R-01          caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A192GQ13_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A223PJ87_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
Q6GZM8_097R-01          caactcagagagtggacagataggctgggtacagtcgggctgattgggag
H9XFR8_097R-01          caactcagagagtggacagataggctgggtacagtcggggtgattgggag
W8TMV3_097R-01          caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A2U9QGY4_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A2U9QHH2_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A220IH18_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A2P1GJP0_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
C3RWV2_097R-01          caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A222NTZ1_097R-01      caactcagagagtggacagataggctgggtacagtcagggtgattgggag
A0A1B2ITU5_097R-01      caactcagagagtggacagatagactgggtacagtcggggtgattgggag
A0A0A0VDG1_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A2D0XKG8_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A223PJJ8_097R-01      caactcagagagtggacagataggctgggtacagtcagggtgattgggag
A0A0D3R3S5_097R-01      caactcagagagtggacagataggctgggtacagtcagggtgattgggag
A0A222NTN8_097R-01      caactcagagagtggacagataggctgggtacagtcagggtgattgggag
T2C510_097R-01          caactcagagagtggacagataggctgggtacagtcagggtgattgggag
V5N073_097R-01          caactcagagagtggacagataggctgggtacagtcagggtgattgggag
A0A2D0XMC5_097R-01      caactcagagagtggacagataggctgggtacagtcagggtgattgggag
                        ** ******************** ***********  ** ********* 

A0A0U2QBA9_097R-01      atgctta---------------aaatggttgggag------------cg-
A0A0U2QHX4_097R-01      atgctta---------------aagtggttgggag------------cg-
Q6YH32_097R-01          atgctta---------------aagtggttgggag------------cg-
A0A0U2R7T3_097R-01      atgctta---------------aagtggttgggag------------cg-
Q2WEP2_097R-01          atgctta---------------gagtggttgggagcgggagtgataacgg
I2BFW4_097R-01          atgcttagagtggttggagcgggagtggttgggag------------tg-
D3TTY2_097R-01          atgctta---------------gagtggttgggag------------cg-
A0A0D3R3I2_097R-01      atgctta---------------gagtggttgggag------------tg-
H6WEE3_097R-01          atgctta---------------gagtggttgggag------------cg-
A0A192GQ13_097R-01      atgctta---------------gagtggttgggag------------cg-
A0A223PJ87_097R-01      atgctta---------------gagtggttgggag------------cg-
Q6GZM8_097R-01          atgctta---------------gagtggttgggag------------cg-
H9XFR8_097R-01          atgctta---------------gagtggttgggag------------cg-
W8TMV3_097R-01          atgctta---------------gagtggttgggag------------cg-
A0A2U9QGY4_097R-01      atgctta---------------gagtggttgggag------------cg-
A0A2U9QHH2_097R-01      atgctta---------------gagtggttgggag------------cg-
A0A220IH18_097R-01      atgctta---------------gagtggttgggag------------cg-
A0A2P1GJP0_097R-01      atgctta---------------gagtggttgggag------------cg-
C3RWV2_097R-01          atgctta---------------gagtggttgggag------------cg-
A0A222NTZ1_097R-01      atgctta---------------gagtggttgggag------------cg-
A0A1B2ITU5_097R-01      atgctta---------------gagtggttgggag------------cg-
A0A0A0VDG1_097R-01      atgctta---------------gagtggttgggag------------cgg
A0A2D0XKG8_097R-01      atgctta---------------gagtggttgggag------------cg-
A0A223PJJ8_097R-01      atgctta---------------gagtggttgggag------------cg-
A0A0D3R3S5_097R-01      atgctta---------------gagtggttgggag------------cg-
A0A222NTN8_097R-01      atgctta---------------gagtggttgggag------------cg-
T2C510_097R-01          atgctta---------------gagtggttgggag------------cg-
V5N073_097R-01          atgctta---------------gagtggttgggag------------cg-
A0A2D0XMC5_097R-01      atgctta---------------gagtggttgggag------------cg-
                        *******                * **********             * 

A0A0U2QBA9_097R-01      -----------------------ggagtgatcactggagtggtcctgtct
A0A0U2QHX4_097R-01      -----------------------ggagtgatcactggagtggtcctgtct
Q6YH32_097R-01          -----------------------ggagtgatcactggagtggtcctgtct
A0A0U2R7T3_097R-01      -----------------------ggagtgatcactggagtggtcctgtct
Q2WEP2_097R-01          gagtgataacgggagtgataacgggagtgataacgggagtgatcctgtct
I2BFW4_097R-01          -----------ggagtgatcactggagtgatcactggagtggtcctgtct
D3TTY2_097R-01          -----------------------ggagtgatcactggagtggtcctgtct
A0A0D3R3I2_097R-01      -----------------------ggagtgatcactggagtggtcctgtct
H6WEE3_097R-01          -----------------------ggagtgatcactggagtggtcctgtct
A0A192GQ13_097R-01      -----------ggagcgatcgcgggagtgatcgctggagtggtcctgtct
A0A223PJ87_097R-01      -----------------------ggagtgatcactggagtggtcctatct
Q6GZM8_097R-01          -----------------------ggagtgatcactggagtggtcctatct
H9XFR8_097R-01          -----------------------ggagtgatcactggagtggtcctgtct
W8TMV3_097R-01          -----------------------ggagtgatcactggagtggtcctatct
A0A2U9QGY4_097R-01      -----------------------ggagtgatcactggagtggtcctatct
A0A2U9QHH2_097R-01      -----------------------ggagtgatcactggagtggtcctatct
A0A220IH18_097R-01      -----------------------ggagtgatcactggagtggtcctgtct
A0A2P1GJP0_097R-01      -----------------------ggagtgatcactggagtggtcctgtct
C3RWV2_097R-01          -----------------------ggagtgatcactggagtggtcctgtct
A0A222NTZ1_097R-01      -----------------------ggagtgatcactggagtggtcctgtct
A0A1B2ITU5_097R-01      -----------------------ggagtgatcactggagtggtcctgtct
A0A0A0VDG1_097R-01      gagtgatcactggagtgatcactggagtgatcactggagtggtcctgtct
A0A2D0XKG8_097R-01      -----------ggagtgatcactggagtgatcactggagtggtcctgtct
A0A223PJJ8_097R-01      -----------------------ggagtgatcactggagtggtcctgtct
A0A0D3R3S5_097R-01      -----------ggagtgatcactggagtgatcactggagtggtcctgtct
A0A222NTN8_097R-01      -----------ggagtgatcactggagtgatcactggagtggtcctgtct
T2C510_097R-01          -----------------------ggagtgatcactggagtggtcctgtct
V5N073_097R-01          -----------------------ggagtgatcactggagtggtcctgtct
A0A2D0XMC5_097R-01      -----------ggagtgatcactggagtgatcactggagtggtcctgtct
                                               ********  * ****** **** ***

A0A0U2QBA9_097R-01      cttttgttctcttga
A0A0U2QHX4_097R-01      cttttgttctcttga
Q6YH32_097R-01          cttttgttctcttga
A0A0U2R7T3_097R-01      cttttgttctcttga
Q2WEP2_097R-01          ctcttgttctcttga
I2BFW4_097R-01          ctcttgttctcttga
D3TTY2_097R-01          ctcttgttctcttga
A0A0D3R3I2_097R-01      ctcttgttctcttga
H6WEE3_097R-01          ctcttgttctcttga
A0A192GQ13_097R-01      ctcttgttctcttga
A0A223PJ87_097R-01      ctcttgttctattga
Q6GZM8_097R-01          ctcttgttctattga
H9XFR8_097R-01          ctcttgttctattga
W8TMV3_097R-01          ctcttgttctattga
A0A2U9QGY4_097R-01      ctcttgttctattga
A0A2U9QHH2_097R-01      ctcttgttctattga
A0A220IH18_097R-01      ctcttgttctcttga
A0A2P1GJP0_097R-01      ctcttgttctattga
C3RWV2_097R-01          ctcttgttctattga
A0A222NTZ1_097R-01      ctcttgttctcttga
A0A1B2ITU5_097R-01      ctcttgttctcttga
A0A0A0VDG1_097R-01      ctcttgttctcttga
A0A2D0XKG8_097R-01      ctcttgttctcttga
A0A223PJJ8_097R-01      ctcttgttctcttga
A0A0D3R3S5_097R-01      ctcttgttctcttga
A0A222NTN8_097R-01      ctcttgttctcttga
T2C510_097R-01          ctcttgttctcttga
V5N073_097R-01          ctcttgttctcttga
A0A2D0XMC5_097R-01      ctcttgttctcttga
                        ** ******* ****

© 1998-2019