Dataset for CDS 097R of organism Frog virus 3

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q6GZM8_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A220IH18_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
W8TMV3_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt

Q6GZM8_097R-01          ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
A0A220IH18_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
W8TMV3_097R-01          ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg

Q6GZM8_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A220IH18_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
W8TMV3_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac

Q6GZM8_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A220IH18_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
W8TMV3_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt

Q6GZM8_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A220IH18_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
W8TMV3_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata

Q6GZM8_097R-01          gaacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A220IH18_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
W8TMV3_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
                        * ************************************************

Q6GZM8_097R-01          caactcagagagtggacagataggctgggtacagtcgggctgattgggag
A0A220IH18_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
W8TMV3_097R-01          caactcagagagtggacagataggctgggtacagtcggggtgattgggag
                        *************************************** **********

Q6GZM8_097R-01          atgcttagagtggttgggagcgggagtgatcactggagtggtcctatctc
A0A220IH18_097R-01      atgcttagagtggttgggagcgggagtgatcactggagtggtcctgtctc
W8TMV3_097R-01          atgcttagagtggttgggagcgggagtgatcactggagtggtcctatctc
                        ********************************************* ****

Q6GZM8_097R-01          tcttgttctattga
A0A220IH18_097R-01      tcttgttctcttga
W8TMV3_097R-01          tcttgttctattga
                        ********* ****

© 1998-2019