Dataset for CDS iridoviridae of organism Ambystoma tigrinum virus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A0U2QBA9_097R-01      atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0U2QHX4_097R-01      atggacgtgaggcaatttctgttagactgcgaagctcccgaggagatggt
A0A0U2R7T3_097R-01      atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
                        ********************** ***************************

A0A0U2QBA9_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacatggcctgtg
A0A0U2QHX4_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacatggcctgtg
A0A0U2R7T3_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacatggcctgtg

A0A0U2QBA9_097R-01      cccacctgtacaccatgctgtgggaaggcatcaacctggaggaggttcac
A0A0U2QHX4_097R-01      cccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A0U2R7T3_097R-01      cccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcac
                        ***************************** ********************

A0A0U2QBA9_097R-01      gcatccttcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A0U2QHX4_097R-01      gcatccttcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A0U2R7T3_097R-01      gcatccttcctgggagacggcgttgtaaactggggcagggtggccgcgtt

A0A0U2QBA9_097R-01      tatgcacatctgcaggtacaccgtcaggacctttccgtctagcatggata
A0A0U2QHX4_097R-01      tatgcacatctgcaggtacaccgtcaggacctttccgtctagcatggata
A0A0U2R7T3_097R-01      tatgcacatctgcaggtacaccgtcaggacctttccgtctagcatggata

A0A0U2QBA9_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatatacaag
A0A0U2QHX4_097R-01      ggacagaggttgctttgactaaatttatacaggacccaaagatatacaag
A0A0U2R7T3_097R-01      ggacagaggttgctttgactaaatttatacaggacccaaagatatacaag
                        ************** ***********************************

A0A0U2QBA9_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A0U2QHX4_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A0U2R7T3_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag

A0A0U2QBA9_097R-01      atgcttaaaatggttgggagcgggagtgatcactggagtggtcctgtctc
A0A0U2QHX4_097R-01      atgcttaaagtggttgggagcgggagtgatcactggagtggtcctgtctc
A0A0U2R7T3_097R-01      atgcttaaagtggttgggagcgggagtgatcactggagtggtcctgtctc
                        ********* ****************************************

A0A0U2QBA9_097R-01      ttttgttctcttga
A0A0U2QHX4_097R-01      ttttgttctcttga
A0A0U2R7T3_097R-01      ttttgttctcttga

© 1998-2019