Dataset for CDS ORF16 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

P90504_ORF16-01      atggacgaggacgttttgcctggagaggtgttggccattgaagggatatt
F5HGJ3_ORF16-01      atggacgaggacgttttgcctggagaggtgttggccattgaagggatatt
Q76RI8_ORF16-01      atggacgaggacgttttgcctggagaggtgttggccattgaagggatatt

P90504_ORF16-01      catggcctgtggattaaacgaacctgagtacctgtaccatcctttgctca
F5HGJ3_ORF16-01      catggcctgtggattaaacgaacctgagtacctgtaccatcctttgctca
Q76RI8_ORF16-01      catggcctgtggattaaacgaacctgagtacctgtaccatcctttgctca

P90504_ORF16-01      gccctattaagctatacatcacaggcttaatgcgagacaaggagtcttta
F5HGJ3_ORF16-01      gccctattaagctatacatcacaggcttaatgcgagacaaggagtcttta
Q76RI8_ORF16-01      gccctattaagctatacatcacaggcttaatgcgagacaaggagtcttta

P90504_ORF16-01      ttcgaggccatgttggctaatgtgagatttcacagcaccaccggtataaa
F5HGJ3_ORF16-01      ttcgaggccatgttggctaatgtgagatttcacagcaccaccggtataaa
Q76RI8_ORF16-01      ttcgaggccatgttggctaatgtgagatttcacagcaccaccggtataaa

P90504_ORF16-01      ccagcttgggttgagcatgctgcaggttagcggcgatggaaacatgaact
F5HGJ3_ORF16-01      ccagcttgggttgagcatgctgcaggttagcggcgatggaaacatgaact
Q76RI8_ORF16-01      ccagcttgggttgagcatgctgcaggttagcggcgatggaaacatgaact

P90504_ORF16-01      gggggcgagccctggctatactgacctttggcagttttgtggcccagaag
F5HGJ3_ORF16-01      gggggcgagccctggctatactgacctttggcagttttgtggcccagaag
Q76RI8_ORF16-01      gggggcgagccctggctatactgacctttggcagttttgtggcccagaag

P90504_ORF16-01      ttatccaacgaacctcacctgcgagactttgctttggccgttttacctgt
F5HGJ3_ORF16-01      ttatccaacgaacctcacctgcgagactttgctttggccgttttacctgt
Q76RI8_ORF16-01      ttatccaacgaacctcacctgcgagactttgctttggccgttttacctgt

P90504_ORF16-01      atatgcgtatgaagcaatcggaccccagtggtttcgcgctcgcggaggct
F5HGJ3_ORF16-01      atatgcgtatgaagcaatcggaccccagtggtttcgcgctcgcggaggct
Q76RI8_ORF16-01      atatgcgtatgaagcaatcggaccccagtggtttcgcgctcgcggaggct

P90504_ORF16-01      ggcgaggcctgaaggcgtattgtacacaggtgcttaccagaagaagggga
F5HGJ3_ORF16-01      ggcgaggcctgaaggcgtattgtacacaggtgcttaccagaagaagggga
Q76RI8_ORF16-01      ggcgaggcctgaaggcgtattgtacacaggtgcttaccagaagaagggga

P90504_ORF16-01      cggagaatgacagcgctattgggaagcattgcattattggccactatatt
F5HGJ3_ORF16-01      cggagaatgacagcgctattgggaagcattgcattattggccactatatt
Q76RI8_ORF16-01      cggagaatgacagcgctattgggaagcattgcattattggccactatatt

P90504_ORF16-01      ggcagcggtcgcgatgagcaggagataa
F5HGJ3_ORF16-01      ggcagcggtcgcgatgagcaggagataa
Q76RI8_ORF16-01      ggcagcggtcgcgatgagcaggagataa

© 1998-2019