Dataset for CDS M11 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


P89884_M11-01      atgagtcataagaaaagcgggacttattgggcaaccctgattacagccttcttgaagact
B1PZP0_M11-01      atgagtcataagaaaagcgggacttattgggcaaccctgattacagccttcttgaagact
D0U1R1_M11-01      atgagtcataagaggactgggacttattgggcaaccataattactgcctttttgaagtct
                   *************  *  ****************** * ***** ***** ****** **

P89884_M11-01      gtttctaaagtggaagaactggattgtgttgattctgctgtgttagttgatgtctctaaa
B1PZP0_M11-01      gtttctaaagtggaagaactggattgtgttgattctgctgtgttagttgatgtctctaaa
D0U1R1_M11-01      gtttctaaggtggaagaactggattgctatgattcggatgtgttggatgatgtctcgaaa
                   ******** *****************   ****** * ****** * ********* ***

P89884_M11-01      ataataacattgacccaggagtttagaaggcactatgacagcgtttaccgcgcggattat
B1PZP0_M11-01      ataataacattgacccaggagtttagaaggcactatgacagcgtttaccgcgcggattat
D0U1R1_M11-01      atcataacattgactcaagagttcagaagtcactatgacagtgtcttccatatggattat
                   ** *********** ** ***** ***** *********** ** * **    *******

P89884_M11-01      ggccctgccctcaagaactggaaaagagacctgtccaaacttttcacctcgttgtttgta
B1PZP0_M11-01      ggccctgccctcaagaactggaaaagagacctgtccaaacttttcacctcgttgtttgta
D0U1R1_M11-01      ggccctgcccttcaaaactggaaagggggcctggctagactttttacctcattgtttgga
                   ***********  * ********* * * **** * * ****** ***** ******* *

P89884_M11-01      gatgtcatcaacagtggaagaattgttggattttttgatgttggcagatatgtgtgtgag
B1PZP0_M11-01      gatgtcatcaacagtggaagaattgttggattttttgatgttggcagatatgtgtgtgag
D0U1R1_M11-01      gatgccatcaatagggggagaattgttggattttttgatgttggaagatatgtgtgtgaa
                   **** ****** ** ** ************************** ************** 

P89884_M11-01      gaggtactatgtcccggcagttggacggaggatcatgaattattgaacgattgcatgaca
B1PZP0_M11-01      gaggtactatgtcccggcagttggacggaggatcatgaattattgaacgattgcatgaca
D0U1R1_M11-01      gagctactgtgtccaggcagttggacggaggaacatgatttattgaacgaatacatgaca
                   *** **** ***** ***************** ***** *********** * *******

P89884_M11-01      cacttttttattgaaaacaatttaatgaaccattttccattagaagacatatttttggca
B1PZP0_M11-01      cacttttttattgaaaacaatttaatgaaccattttccattagaagacatatttttggca
D0U1R1_M11-01      cagttttttattgaaaacaatttaatgaactatttttcccttgaagacacattttgtaca
                   ** *************************** ***** *  * ******* *****   **

P89884_M11-01      cagagaaaattccagaccactggctttacattcttgttgcatgccctggcgaaggtgttg
B1PZP0_M11-01      cagagaaaattccagaccactggctttacattcttgttgcatgccctggcgaaggtgttg
D0U1R1_M11-01      cagacaaaattccataacatgggatttagccttgcattgagtatcctgtgtcgggcgctg
                   **** ********* * **  ** ****   *    ***  *  ****     ** * **

P89884_M11-01      cccaggatatattctgggaatgtgatttatgtctga
B1PZP0_M11-01      cccaggatatattctgggaatgtgatttatgtctga
D0U1R1_M11-01      accaggatatattctggtgatgtgatctatgtctga
                    ****************  ******* *********

© 1998-2018