Dataset for CDS herpesviridae of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

95 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H3ALX7_vNR13-01         --------------------------------------------------
Q90343_vNR13-01         --------------------------------------------------
Q9E1F2_vNR13-01         --------------------------------------------------
Q9E1F2_vNR13-02         --------------------------------------------------
P90504_ORF16-01         atgg----------------------------------------------
F5HGJ3_ORF16-01         atgg----------------------------------------------
Q76RI8_ORF16-01         atgg----------------------------------------------
Q99F66_BALF1-01         --------------------------------------------------
A0A075FCZ0_BALF1-0      --------------------------------------------------
A0A075FFB0_BALF1-0      --------------------------------------------------
A0A0C7TV67_BALF1-0      --------------------------------------------------
A0A2S1N1Z2_BALF1-0      atgaaccgggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1N2H2_BALF1-0      atgaaccgggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MZQ8_BALF1-0      atgaacctggccattactctggactctcctcacccaggcctcgcgtctta
U5YUM6_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0U3UKR9_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2D1LYV4_BALF1-0      --------------------------------------------------
Q91HV2_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TPI3_BALF1-0      --------------------------------------------------
A0A2S1MQV1_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7T8J1_BALF1-0      --------------------------------------------------
A0A2S1MP06_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MXY9_BALF1-0      atgaacctggccattgctctggactttcctcacccaggcctcgcgtctta
A0A0S2YQW9_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TJ32_BALF1-0      --------------------------------------------------
A0A2S1MV59_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MU91_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MM94_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0U3U737_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TLW1_BALF1-0      --------------------------------------------------
K9UT94_BALF1-01         --------------------------------------------------
P0CK58_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
P0CK59_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TUX3_BALF1-0      --------------------------------------------------
A0A2S1MTH2_BALF1-0      atgaacctggccattgctctggactctcatcacccaggcctcgcgtctta
Q91HI3_BALF1-01         --------------------------------------------------
Q99F65_BALF1-01         --------------------------------------------------
A1BM64_A9-01            --------------------------------------------------
Q2VSG7_A9-01            --------------------------------------------------
A0A1L2JVL1_A9-01        --------------------------------------------------
O36423_A9-01            --------------------------------------------------
Q1XBS8_VBCL2-01         --------------------------------------------------
Q1XBS6_VBCL2-01         --------------------------------------------------
Q1XBS7_VBCL2-01         --------------------------------------------------
Q99D15_VBCL2-01         --------------------------------------------------
Q9WH78_VBCL2-01         --------------------------------------------------
P89884_M11-01           --------------------------------------------------
B1PZP0_M11-01           --------------------------------------------------
D0U1R1_M11-01           --------------------------------------------------
Q9Q5K8_BHRF1-01         --------------------------------------------------
Q9WGB5_BHRF1-01         --------------------------------------------------
Q9IHR2_BHRF1-01         --------------------------------------------------
A0A0S2YQS0_BHRF1-0      --------------------------------------------------
A0A2H4Z4F2_BHRF1-0      --------------------------------------------------
A0A0C7TQI4_BHRF1-0      --------------------------------------------------
A0A2S1N164_BHRF1-0      --------------------------------------------------
A0A0B6VHG4_BHRF1-0      --------------------------------------------------
A0A2H4Z4D6_BHRF1-0      --------------------------------------------------
A0A2H4Z4I0_BHRF1-0      --------------------------------------------------
A0A2H4Z4M5_BHRF1-0      --------------------------------------------------
A0A2H4Z4H8_BHRF1-0      --------------------------------------------------
A0A2H4Z4I4_BHRF1-0      --------------------------------------------------
A0A2S1MYK7_BHRF1-0      --------------------------------------------------
A0A2S1MX38_BHRF1-0      --------------------------------------------------
A0A2S1MWX4_BHRF1-0      --------------------------------------------------
A0A2S1MW70_BHRF1-0      --------------------------------------------------
A0A2H4Z4C5_BHRF1-0      --------------------------------------------------
G3CKQ0_BHRF1-01         --------------------------------------------------
A0A0C7U1E2_BHRF1-0      --------------------------------------------------
A0A2S1N3G0_BHRF1-0      --------------------------------------------------
V5KUE2_BHRF1-02         --------------------------------------------------
A0A0C7T306_BHRF1-0      --------------------------------------------------
A0A0C7T6R4_BHRF1-0      --------------------------------------------------
A0A0C7T924_BHRF1-0      --------------------------------------------------
A0A0X9C4Q9_BHRF1-0      --------------------------------------------------
A0A0X8YIW3_BHRF1-0      --------------------------------------------------
A0A2H4Z4F8_BHRF1-0      --------------------------------------------------
A0A2H4Z4E3_BHRF1-0      --------------------------------------------------
A0A2H4Z4D9_BHRF1-0      --------------------------------------------------
K9UTF7_BHRF1-01         --------------------------------------------------
A0A0C7TWM2_BHRF1-0      --------------------------------------------------
A0A2D1LYW3_BHRF1-0      --------------------------------------------------
A0A0C7TK05_BHRF1-0      --------------------------------------------------
P03182_BHRF1-01         --------------------------------------------------
A0A2S1N3U3_BHRF1-0      --------------------------------------------------
A0A2S1MNB9_BHRF1-0      --------------------------------------------------
A0A2S1MMY2_BHRF1-0      --------------------------------------------------
A0A0S2YRE8_BHRF1-0      --------------------------------------------------
A0A0C7TX82_BHRF1-0      --------------------------------------------------
A0A0C7TTN2_BHRF1-0      --------------------------------------------------
A0A0C7TNT4_BHRF1-0      --------------------------------------------------
A0A0C7SXB3_BHRF1-0      --------------------------------------------------
K9UTN7_BHRF1-01         --------------------------------------------------
P0C6Z1_BHRF1-01         --------------------------------------------------
V5KU29_BHRF1-02         --------------------------------------------------
                                                                          

H3ALX7_vNR13-01         --------------------------------------------------
Q90343_vNR13-01         --------------------------------------------------
Q9E1F2_vNR13-01         --------------------------------------------------
Q9E1F2_vNR13-02         --------------------------------------------------
P90504_ORF16-01         --------------------------------------------------
F5HGJ3_ORF16-01         --------------------------------------------------
Q76RI8_ORF16-01         --------------------------------------------------
Q99F66_BALF1-01         --------------------------------------------------
A0A075FCZ0_BALF1-0      --------------------------------------------------
A0A075FFB0_BALF1-0      --------------------------------------------------
A0A0C7TV67_BALF1-0      --------------------------------------------------
A0A2S1N1Z2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1N2H2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MZQ8_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
U5YUM6_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0U3UKR9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgaact
A0A2D1LYV4_BALF1-0      --------------------------------------------------
Q91HV2_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TPI3_BALF1-0      --------------------------------------------------
A0A2S1MQV1_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7T8J1_BALF1-0      --------------------------------------------------
A0A2S1MP06_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MXY9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0S2YQW9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TJ32_BALF1-0      --------------------------------------------------
A0A2S1MV59_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MU91_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MM94_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0U3U737_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TLW1_BALF1-0      --------------------------------------------------
K9UT94_BALF1-01         --------------------------------------------------
P0CK58_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
P0CK59_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TUX3_BALF1-0      --------------------------------------------------
A0A2S1MTH2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
Q91HI3_BALF1-01         --------------------------------------------------
Q99F65_BALF1-01         --------------------------------------------------
A1BM64_A9-01            --------------------------------------------------
Q2VSG7_A9-01            --------------------------------------------------
A0A1L2JVL1_A9-01        --------------------------------------------------
O36423_A9-01            --------------------------------------------------
Q1XBS8_VBCL2-01         --------------------------------------------------
Q1XBS6_VBCL2-01         --------------------------------------------------
Q1XBS7_VBCL2-01         --------------------------------------------------
Q99D15_VBCL2-01         --------------------------------------------------
Q9WH78_VBCL2-01         --------------------------------------------------
P89884_M11-01           --------------------------------------------------
B1PZP0_M11-01           --------------------------------------------------
D0U1R1_M11-01           --------------------------------------------------
Q9Q5K8_BHRF1-01         --------------------------------------------------
Q9WGB5_BHRF1-01         --------------------------------------------------
Q9IHR2_BHRF1-01         --------------------------------------------------
A0A0S2YQS0_BHRF1-0      --------------------------------------------------
A0A2H4Z4F2_BHRF1-0      --------------------------------------------------
A0A0C7TQI4_BHRF1-0      --------------------------------------------------
A0A2S1N164_BHRF1-0      --------------------------------------------------
A0A0B6VHG4_BHRF1-0      --------------------------------------------------
A0A2H4Z4D6_BHRF1-0      --------------------------------------------------
A0A2H4Z4I0_BHRF1-0      --------------------------------------------------
A0A2H4Z4M5_BHRF1-0      --------------------------------------------------
A0A2H4Z4H8_BHRF1-0      --------------------------------------------------
A0A2H4Z4I4_BHRF1-0      --------------------------------------------------
A0A2S1MYK7_BHRF1-0      --------------------------------------------------
A0A2S1MX38_BHRF1-0      --------------------------------------------------
A0A2S1MWX4_BHRF1-0      --------------------------------------------------
A0A2S1MW70_BHRF1-0      --------------------------------------------------
A0A2H4Z4C5_BHRF1-0      --------------------------------------------------
G3CKQ0_BHRF1-01         --------------------------------------------------
A0A0C7U1E2_BHRF1-0      --------------------------------------------------
A0A2S1N3G0_BHRF1-0      --------------------------------------------------
V5KUE2_BHRF1-02         --------------------------------------------------
A0A0C7T306_BHRF1-0      --------------------------------------------------
A0A0C7T6R4_BHRF1-0      --------------------------------------------------
A0A0C7T924_BHRF1-0      --------------------------------------------------
A0A0X9C4Q9_BHRF1-0      --------------------------------------------------
A0A0X8YIW3_BHRF1-0      --------------------------------------------------
A0A2H4Z4F8_BHRF1-0      --------------------------------------------------
A0A2H4Z4E3_BHRF1-0      --------------------------------------------------
A0A2H4Z4D9_BHRF1-0      --------------------------------------------------
K9UTF7_BHRF1-01         --------------------------------------------------
A0A0C7TWM2_BHRF1-0      --------------------------------------------------
A0A2D1LYW3_BHRF1-0      --------------------------------------------------
A0A0C7TK05_BHRF1-0      --------------------------------------------------
P03182_BHRF1-01         --------------------------------------------------
A0A2S1N3U3_BHRF1-0      --------------------------------------------------
A0A2S1MNB9_BHRF1-0      --------------------------------------------------
A0A2S1MMY2_BHRF1-0      --------------------------------------------------
A0A0S2YRE8_BHRF1-0      --------------------------------------------------
A0A0C7TX82_BHRF1-0      --------------------------------------------------
A0A0C7TTN2_BHRF1-0      --------------------------------------------------
A0A0C7TNT4_BHRF1-0      --------------------------------------------------
A0A0C7SXB3_BHRF1-0      --------------------------------------------------
K9UTN7_BHRF1-01         --------------------------------------------------
P0C6Z1_BHRF1-01         --------------------------------------------------
V5KU29_BHRF1-02         --------------------------------------------------
                                                                          

H3ALX7_vNR13-01         --------------atgtgcgattcg----ttgaaagaggaaacccgact
Q90343_vNR13-01         --------------atgccgggctct----ctgaaggaggagacggcgct
Q9E1F2_vNR13-01         --------------atggctgactcc----ctgaaggaagaaacggcgtt
Q9E1F2_vNR13-02         --------------atggctgactcc----ctgaaggaagaaacggcgtt
P90504_ORF16-01         --------------acgaggac-gtt----ttgcctggaga---ggtgtt
F5HGJ3_ORF16-01         --------------acgaggac-gtt----ttgcctggaga---ggtgtt
Q76RI8_ORF16-01         --------------acgaggac-gtt----ttgcctggaga---ggtgtt
Q99F66_BALF1-01         --------------atgaaggccgcc----aagtctacagattcggtgtt
A0A075FCZ0_BALF1-0      --------------atgaggccagcc----aagtctacagattctgtgtt
A0A075FFB0_BALF1-0      --------------atgaggccagcc----aagtctacagattctgtgtt
A0A0C7TV67_BALF1-0      --------------atgaggccagcc----aagtctacagattctgtgtt
A0A2S1N1Z2_BALF1-0      ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
A0A2S1N2H2_BALF1-0      ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
A0A2S1MZQ8_BALF1-0      ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
U5YUM6_BALF1-01         ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
A0A0U3UKR9_BALF1-0      ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
A0A2D1LYV4_BALF1-0      --------------atgaggccagcc----aagtctacagattctgtgtt
Q91HV2_BALF1-01         ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
A0A0C7TPI3_BALF1-0      --------------atgaggccagcc----aagtctacagattctgtgtt
A0A2S1MQV1_BALF1-0      ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
A0A0C7T8J1_BALF1-0      --------------atgaggccagcc----aagtctacagattctgtgtt
A0A2S1MP06_BALF1-0      ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
A0A2S1MXY9_BALF1-0      ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
A0A0S2YQW9_BALF1-0      ggcctgacgagaccatgaggcaagcc----aagtctacagattctgtgtt
A0A0C7TJ32_BALF1-0      --------------atgaggccagcc----aagtctacagattctgtgtt
A0A2S1MV59_BALF1-0      ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
A0A2S1MU91_BALF1-0      ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
A0A2S1MM94_BALF1-0      ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
A0A0U3U737_BALF1-0      ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
A0A0C7TLW1_BALF1-0      --------------atgaggccagcc----aagtctacagattctgtgtt
K9UT94_BALF1-01         --------------atgaggccagcc----aagtctacagattctgtgtt
P0CK58_BALF1-01         ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
P0CK59_BALF1-01         ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
A0A0C7TUX3_BALF1-0      --------------atgaggcaagcc----aagtctacagattctgtgtt
A0A2S1MTH2_BALF1-0      ggcctgacgagaccatgaggccagcc----aagtctacagattctgtgtt
Q91HI3_BALF1-01         --------------atgaggccggcc----aagtctacagattccgtgtt
Q99F65_BALF1-01         --------------atgaggccagcc----gagtctacagattccgtgtt
A1BM64_A9-01            --------------atggtggaagctggcatactatcaaggaaagtaacc
Q2VSG7_A9-01            --------------atggtggaagctggcatactatcaaggaaagtaacc
A0A1L2JVL1_A9-01        --------------atgaa------------------aatgttgggaga-
O36423_A9-01            --------------atgaa------------------aatgttgggaga-
Q1XBS8_VBCL2-01         --------------atgtctctgttttttattgtttggtactgggtgaat
Q1XBS6_VBCL2-01         --------------atgtctctgttttttgttgtttggtactgggtgaat
Q1XBS7_VBCL2-01         --------------atgtctctgttttttgttgtttggtactgggtgaat
Q99D15_VBCL2-01         --------------atgtctctgttttttgttgtttggtactgggtgaat
Q9WH78_VBCL2-01         --------------atgtctctgttttttgttgtttggtactgggtgaat
P89884_M11-01           --------------atgag-----------tcataagaaaagcgggactt
B1PZP0_M11-01           --------------atgag-----------tcataagaaaagcgggactt
D0U1R1_M11-01           --------------atgag-----------tcataagaggactgggactt
Q9Q5K8_BHRF1-01         --------------atggc-----------ctattctacaa--gggattt
Q9WGB5_BHRF1-01         --------------atggc-----------ctattctacaa--gggattt
Q9IHR2_BHRF1-01         --------------atggc-----------ctattcaacaa--gggatat
A0A0S2YQS0_BHRF1-0      --------------atggc-----------ccattcaacaa--gggagat
A0A2H4Z4F2_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A0C7TQI4_BHRF1-0      --------------atggc-----------ctattcaacaa--gggatat
A0A2S1N164_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A0B6VHG4_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2H4Z4D6_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2H4Z4I0_BHRF1-0      --------------atggc-----------ctattcaacaa--gggatat
A0A2H4Z4M5_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2H4Z4H8_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2H4Z4I4_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2S1MYK7_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2S1MX38_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2S1MWX4_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2S1MW70_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2H4Z4C5_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
G3CKQ0_BHRF1-01         --------------atggc-----------ctattcaacaa--gggagat
A0A0C7U1E2_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2S1N3G0_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
V5KUE2_BHRF1-02         --------------atggc-----------ctattcaacaa--gggagat
A0A0C7T306_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A0C7T6R4_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A0C7T924_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A0X9C4Q9_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A0X8YIW3_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2H4Z4F8_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2H4Z4E3_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2H4Z4D9_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
K9UTF7_BHRF1-01         --------------atggc-----------ctattcaacaa--gggagat
A0A0C7TWM2_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2D1LYW3_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A0C7TK05_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
P03182_BHRF1-01         --------------atggc-----------ctattcaacaa--gggagat
A0A2S1N3U3_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2S1MNB9_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A2S1MMY2_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A0S2YRE8_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A0C7TX82_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A0C7TTN2_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A0C7TNT4_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
A0A0C7SXB3_BHRF1-0      --------------atggc-----------ctattcaacaa--gggagat
K9UTN7_BHRF1-01         --------------atggc-----------ctattcaacaa--gggagat
P0C6Z1_BHRF1-01         --------------atggc-----------ctattcaacaa--gggagat
V5KU29_BHRF1-02         --------------atggc-----------ctattcaacaa--gggagat
                                      * *                                 

H3ALX7_vNR13-01         cttggctaacgatttcatccagttttgcctcggcagcggccggact---g
Q90343_vNR13-01         gctgctggaggattacttccagcaccgggccggcgg-ggccgcgct---g
Q9E1F2_vNR13-01         gctgctggaggattacttccagcactgctgcggcaa-ggaagggcc---g
Q9E1F2_vNR13-02         gctgctggaggattacttccagcactgctgcggcaa-ggaagggcc---g
P90504_ORF16-01         gg------------ccattgaa---------gggata------ttcatgg
F5HGJ3_ORF16-01         gg------------ccattgaa---------gggata------ttcatgg
Q76RI8_ORF16-01         gg------------ccattgaa---------gggata------ttcatgg
Q99F66_BALF1-01         tgtg----aggaccccggtcga---------ggcgtgggtctcgccttcc
A0A075FCZ0_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A075FFB0_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A0C7TV67_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A2S1N1Z2_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A2S1N2H2_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A2S1MZQ8_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
U5YUM6_BALF1-01         tgtg----aagaccccggtcga---------ggcgtgggtcgcgccctcg
A0A0U3UKR9_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A2D1LYV4_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
Q91HV2_BALF1-01         tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A0C7TPI3_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A2S1MQV1_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A0C7T8J1_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A2S1MP06_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A2S1MXY9_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A0S2YQW9_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccatcg
A0A0C7TJ32_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A2S1MV59_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgcccttg
A0A2S1MU91_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A2S1MM94_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A0U3U737_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A0C7TLW1_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
K9UT94_BALF1-01         tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
P0CK58_BALF1-01         tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
P0CK59_BALF1-01         tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A0C7TUX3_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
A0A2S1MTH2_BALF1-0      tgtg----aggaccccggtcga---------ggcgtgggtcgcgccctcg
Q91HI3_BALF1-01         tgtg----aggaccccagtaga---------ggcgtgggtcgcgccatcg
Q99F65_BALF1-01         tgtg----aggaccccggtcga---------ggcgtgggtcgcgccgtcg
A1BM64_A9-01            actgggagcc--------actg---------------gactttcttcacc
Q2VSG7_A9-01            actgggagcc--------actg---------------gactttcttcacc
A0A1L2JVL1_A9-01        ------acccgagtttaaggag---------------aacat--------
O36423_A9-01            ------acccgagtttaaggag---------------aacat--------
Q1XBS8_VBCL2-01         tatataacaaaggtgtgttctg---------------gggaggtatatat
Q1XBS6_VBCL2-01         tatataacaaaggtgtgttctg---------------gggaggtatatat
Q1XBS7_VBCL2-01         tatataacaaaggtgtgttctg---------------gggaggtatatat
Q99D15_VBCL2-01         tatataacaaaggtgtgttttg---------------gggaggtatatat
Q9WH78_VBCL2-01         tatataacaaaggtgtgttctg---------------gggaggtatatat
P89884_M11-01           att------------------g---------------ggcaa--------
B1PZP0_M11-01           att------------------g---------------ggcaa--------
D0U1R1_M11-01           att------------------g---------------ggcaa--------
Q9Q5K8_BHRF1-01         actgttagctttgtgtatgcgg---------------gatgg--------
Q9WGB5_BHRF1-01         actgttagctttgtgtatgcgg---------------gatgg--------
Q9IHR2_BHRF1-01         actgttagccctgtgtatgcgg---------------gacag--------
A0A0S2YQS0_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2H4Z4F2_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A0C7TQI4_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2S1N164_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A0B6VHG4_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2H4Z4D6_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2H4Z4I0_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2H4Z4M5_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2H4Z4H8_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2H4Z4I4_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2S1MYK7_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2S1MX38_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2S1MWX4_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2S1MW70_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2H4Z4C5_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
G3CKQ0_BHRF1-01         actgttagccctgtgtatacgg---------------gacag--------
A0A0C7U1E2_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2S1N3G0_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
V5KUE2_BHRF1-02         actgttagccctgtgtatacgg---------------gacag--------
A0A0C7T306_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A0C7T6R4_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A0C7T924_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A0X9C4Q9_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A0X8YIW3_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2H4Z4F8_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2H4Z4E3_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2H4Z4D9_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
K9UTF7_BHRF1-01         actgttagccctgtgtatacgg---------------gacag--------
A0A0C7TWM2_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2D1LYW3_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A0C7TK05_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
P03182_BHRF1-01         actgttagccctgtgtatacgg---------------gacag--------
A0A2S1N3U3_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2S1MNB9_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A2S1MMY2_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A0S2YRE8_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A0C7TX82_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A0C7TTN2_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A0C7TNT4_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
A0A0C7SXB3_BHRF1-0      actgttagccctgtgtatacgg---------------gacag--------
K9UTN7_BHRF1-01         actgttagccctgtgtatacgg---------------gacag--------
P0C6Z1_BHRF1-01         actgttagccctgtgtatacgg---------------gacag--------
V5KU29_BHRF1-02         actgttagccctgtgtatacgg---------------gacag--------
                                                                          

H3ALX7_vNR13-01         cc-cccaaccctgcagcccggg----------------------------
Q90343_vNR13-01         cctcccagcgccacggcggccg----------------------------
Q9E1F2_vNR13-01         ccgccgagtcctacggcggcag----------------------------
Q9E1F2_vNR13-02         ccgccgagtcctacggcggcag----------------------------
P90504_ORF16-01         cctgtggatta-aacgaacctgagtacctgtaccatcctttgctcagccc
F5HGJ3_ORF16-01         cctgtggatta-aacgaacctgagtacctgtaccatcctttgctcagccc
Q76RI8_ORF16-01         cctgtggatta-aacgaacctgagtacctgtaccatcctttgctcagccc
Q99F66_BALF1-01         ccgcccgacgacaaggtcgcggagacca---gctacctcctttttag---
A0A075FCZ0_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A075FFB0_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A0C7TV67_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A2S1N1Z2_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A2S1N2H2_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A2S1MZQ8_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
U5YUM6_BALF1-01         ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A0U3UKR9_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A2D1LYV4_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
Q91HV2_BALF1-01         ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A0C7TPI3_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A2S1MQV1_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A0C7T8J1_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A2S1MP06_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A2S1MXY9_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A0S2YQW9_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A0C7TJ32_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A2S1MV59_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A2S1MU91_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A2S1MM94_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A0U3U737_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A0C7TLW1_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
K9UT94_BALF1-01         ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
P0CK58_BALF1-01         ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
P0CK59_BALF1-01         ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A0C7TUX3_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
A0A2S1MTH2_BALF1-0      ccgccggacgacaaggtggctgagtcca---gctacctcatgttcag---
Q91HI3_BALF1-01         cctccggacgacaaggtggcggagtcca---gctacctcatgttcag---
Q99F65_BALF1-01         ccgccggacgacaaggtggccgagtcca---gctacctcatgttcag---
A1BM64_A9-01            cctcaaaccttgaagaa----------------------------ag---
Q2VSG7_A9-01            ccccaaaccttgaagaa----------------------------ag---
A0A1L2JVL1_A9-01        -cctctattat----------------------------------tc---
O36423_A9-01            -cctctattat----------------------------------tc---
Q1XBS8_VBCL2-01         tccaagtgtattaaagtttcaatatcactctgacactgaacacgagc---
Q1XBS6_VBCL2-01         tccaagtgtattaaagtttcaatatcactctgacactgaacacgagc---
Q1XBS7_VBCL2-01         tccaagtgtattaaagtttcaatatcactctgacactgaacacgagc---
Q99D15_VBCL2-01         tccaagtgtattaaagtttcaatatcactctgacactgaacacgagc---
Q9WH78_VBCL2-01         tccaagtgtattaaagtttcaatatcactctgacactgaacacgagc---
P89884_M11-01           -ccctgattac-----a----------------------------gc---
B1PZP0_M11-01           -ccctgattac-----a----------------------------gc---
D0U1R1_M11-01           -ccataattac-----t----------------------------gc---
Q9Q5K8_BHRF1-01         -tcacgtttatggaggc----------------------------ga---
Q9WGB5_BHRF1-01         -tcacgtttatggaggc----------------------------ga---
Q9IHR2_BHRF1-01         -ttacgtgcatggaaat----------------------------gg---
A0A0S2YQS0_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2H4Z4F2_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A0C7TQI4_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2S1N164_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A0B6VHG4_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2H4Z4D6_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2H4Z4I0_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2H4Z4M5_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2H4Z4H8_BHRF1-0      -tcgtgtgcatggaaat----------------------------gc---
A0A2H4Z4I4_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2S1MYK7_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2S1MX38_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2S1MWX4_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2S1MW70_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2H4Z4C5_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
G3CKQ0_BHRF1-01         -tcgtgtgcatggaaat----------------------------gg---
A0A0C7U1E2_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2S1N3G0_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
V5KUE2_BHRF1-02         -tcgtgtgcatggaaat----------------------------gg---
A0A0C7T306_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A0C7T6R4_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A0C7T924_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A0X9C4Q9_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A0X8YIW3_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2H4Z4F8_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2H4Z4E3_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2H4Z4D9_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
K9UTF7_BHRF1-01         -tcgtgtgcatggaaat----------------------------gg---
A0A0C7TWM2_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2D1LYW3_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A0C7TK05_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
P03182_BHRF1-01         -tcgtgtgcatggaaat----------------------------gg---
A0A2S1N3U3_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2S1MNB9_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A2S1MMY2_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A0S2YRE8_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A0C7TX82_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A0C7TTN2_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A0C7TNT4_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
A0A0C7SXB3_BHRF1-0      -tcgtgtgcatggaaat----------------------------gg---
K9UTN7_BHRF1-01         -tcgtgtgcatggaaat----------------------------gg---
P0C6Z1_BHRF1-01         -tcgtgtgcatggaaat----------------------------gg---
V5KU29_BHRF1-02         -tcgtgtgcatggaaat----------------------------gg---
                                                                          

H3ALX7_vNR13-01         -----tcctgcgcagg-gtgacagcggaactggagc----------ggca
Q90343_vNR13-01         -----agctgcggcgg-gcggcggccgagctggagc----------gacg
Q9E1F2_vNR13-01         -----agctgcggcga-gcggcggccgagctggagc----------ggcg
Q9E1F2_vNR13-02         -----agctgcggcga-gcggcggccgagctggagc----------ggcg
P90504_ORF16-01         tattaagctatacatc-acaggcttaatgcgagaca----------agga
F5HGJ3_ORF16-01         tattaagctatacatc-acaggcttaatgcgagaca----------agga
Q76RI8_ORF16-01         tattaagctatacatc-acaggcttaatgcgagaca----------agga
Q99F66_BALF1-01         -----ggccatgta-c-gcggtgttcacccaggacg----------agac
A0A075FCZ0_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A075FFB0_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A0C7TV67_BALF1-0      -----agccatgta-c-gcggtgttcgcccgggatg----------agaa
A0A2S1N1Z2_BALF1-0      -----agccatgta-c-gcggtgttcgcccgggatg----------agaa
A0A2S1N2H2_BALF1-0      -----agccatgta-c-gcggtgttcgcccgggatg----------agaa
A0A2S1MZQ8_BALF1-0      -----agccatgta-c-gcggtgttcgcccgggatg----------agaa
U5YUM6_BALF1-01         -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A0U3UKR9_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A2D1LYV4_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
Q91HV2_BALF1-01         -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A0C7TPI3_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A2S1MQV1_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A0C7T8J1_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A2S1MP06_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A2S1MXY9_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A0S2YQW9_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A0C7TJ32_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A2S1MV59_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A2S1MU91_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A2S1MM94_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A0U3U737_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A0C7TLW1_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
K9UT94_BALF1-01         -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
P0CK58_BALF1-01         -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
P0CK59_BALF1-01         -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A0C7TUX3_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
A0A2S1MTH2_BALF1-0      -----ggccatgta-c-gcggtgttcacccgggatg----------agaa
Q91HI3_BALF1-01         -----ggcaatgta-c-gcggtgttcacccaggatg----------agac
Q99F65_BALF1-01         -----ggcaatgta-c-gcggtgttctcccgggatg----------agtc
A1BM64_A9-01            -----gggcttg-----cctgtg--gaaggctgg------------ggca
Q2VSG7_A9-01            -----gggcttg-----tctgtg--gaaggctgg------------ggca
A0A1L2JVL1_A9-01        -----attcctaaatgaactgtttttaatatt--------------aata
O36423_A9-01            -----attcctaaatgaactgtttttaatatt--------------aata
Q1XBS8_VBCL2-01         -----cttactctaa--tctgtgtgaaaacttgataaccatggccgagca
Q1XBS6_VBCL2-01         -----cttactccaa--tctgtgtgaaaacttgataaccatggccgagca
Q1XBS7_VBCL2-01         -----cttactccaa--tctgtgtgaaaacttgataaccatggccgagca
Q99D15_VBCL2-01         -----cttactccaa--tctgtgtaaaaacttgataaccatggccgagca
Q9WH78_VBCL2-01         -----cttactccaa--tctgtgtaaaaacttgataaccatggccgagca
P89884_M11-01           -----cttcttgaag--actgtttctaaagtgga------------agaa
B1PZP0_M11-01           -----cttcttgaag--actgtttctaaagtgga------------agaa
D0U1R1_M11-01           -----ctttttgaag--tctgtttctaaggtgga------------agaa
Q9Q5K8_BHRF1-01         -----cggtttgcat--cctgtgttggagttgac------------agca
Q9WGB5_BHRF1-01         -----cggtttgcat--cctgtgttggagttgac------------agca
Q9IHR2_BHRF1-01         -----atctttgcat--cctgtgttggagctagc------------agca
A0A0S2YQS0_BHRF1-0      -----tgtcctgcat--cctgtgttggagctagc------------agca
A0A2H4Z4F2_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A0C7TQI4_BHRF1-0      -----tgccctgcat--cctgtgttggagctagc------------agca
A0A2S1N164_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A0B6VHG4_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A2H4Z4D6_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A2H4Z4I0_BHRF1-0      -----tgccctgcat--cctgtgttggagctagc------------agca
A0A2H4Z4M5_BHRF1-0      -----ttccctgcat--cctgtgttggagctagc------------agca
A0A2H4Z4H8_BHRF1-0      -----ttccctgcat--cctgtgttggagctagc------------agca
A0A2H4Z4I4_BHRF1-0      -----ttccctgcat--cctgtgttggagctagc------------agca
A0A2S1MYK7_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A2S1MX38_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A2S1MWX4_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A2S1MW70_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A2H4Z4C5_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
G3CKQ0_BHRF1-01         -----taccctgcat--cctgtgttggagctagc------------agca
A0A0C7U1E2_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------atca
A0A2S1N3G0_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------atca
V5KUE2_BHRF1-02         -----taccctgcat--cctgtgttggagctagc------------atca
A0A0C7T306_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A0C7T6R4_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A0C7T924_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A0X9C4Q9_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A0X8YIW3_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agcg
A0A2H4Z4F8_BHRF1-0      -----tatcctgcat--cctgtgttggagctagc------------agca
A0A2H4Z4E3_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A2H4Z4D9_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
K9UTF7_BHRF1-01         -----taccctgcat--cctgtgttggagctagc------------agca
A0A0C7TWM2_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A2D1LYW3_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A0C7TK05_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
P03182_BHRF1-01         -----taccctgcat--cctgtgttggagctagc------------agca
A0A2S1N3U3_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------aaca
A0A2S1MNB9_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A2S1MMY2_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A0S2YRE8_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A0C7TX82_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A0C7TTN2_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A0C7TNT4_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
A0A0C7SXB3_BHRF1-0      -----taccctgcat--cctgtgttggagctagc------------agca
K9UTN7_BHRF1-01         -----taccctgcat--cctgtgttggagctagc------------agca
P0C6Z1_BHRF1-01         -----taccctgcat--cctgtgttggagctagc------------agca
V5KU29_BHRF1-02         -----taccctgcat--cctgtgttggagctagc------------agca
                                                                          

H3ALX7_vNR13-01         gaaccaggcgctc----ttcgactcgtttcaggggaactgt---------
Q90343_vNR13-01         ggagcggcccttc----ttccgatcct-----gcgctccgc---------
Q9E1F2_vNR13-01         agagaggcccttc----tttcgctcct-----gcgcgccgt---------
Q9E1F2_vNR13-02         agagaggcccttc----tttcgctcct-----gcgcgccgt---------
P90504_ORF16-01         ------gtcttt--------------------att-----c---------
F5HGJ3_ORF16-01         ------gtcttt--------------------att-----c---------
Q76RI8_ORF16-01         ------gtcttt--------------------att-----c---------
Q99F66_BALF1-01         tgacctgcccac--------------------cccagctca---------
A0A075FCZ0_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A075FFB0_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A0C7TV67_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A2S1N1Z2_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A2S1N2H2_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A2S1MZQ8_BALF1-0      agacctgccttt--------------------gccagccct---------
U5YUM6_BALF1-01         agacctgccttt--------------------gccagccct---------
A0A0U3UKR9_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A2D1LYV4_BALF1-0      agacctgccttt--------------------gccagccct---------
Q91HV2_BALF1-01         agacctgccttt--------------------gccagccct---------
A0A0C7TPI3_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A2S1MQV1_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A0C7T8J1_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A2S1MP06_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A2S1MXY9_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A0S2YQW9_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A0C7TJ32_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A2S1MV59_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A2S1MU91_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A2S1MM94_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A0U3U737_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A0C7TLW1_BALF1-0      agacctgccttt--------------------gccagccct---------
K9UT94_BALF1-01         agacctgccttt--------------------gccagccct---------
P0CK58_BALF1-01         agacctgccttt--------------------gccagccct---------
P0CK59_BALF1-01         agacctgccttt--------------------gccagccct---------
A0A0C7TUX3_BALF1-0      agacctgccttt--------------------gccagccct---------
A0A2S1MTH2_BALF1-0      agacctgccttt--------------------gccagccct---------
Q91HI3_BALF1-01         gggcctgcctct--------------------gccagccat---------
Q99F65_BALF1-01         ggacctgccgct--------------------gccggccgc---------
A1BM64_A9-01            gtatatttccccccagcaagcatgccccccaggaaggcattcaatgacgg
Q2VSG7_A9-01            gtatatttccccccagtaagcatgccccccaggaaggcattcaatgacgg
A0A1L2JVL1_A9-01        agaaatggatttt---cctgcagccacgcaaagttaatacttgatgaaac
O36423_A9-01            agaaatggatttt---cctgcagccacgcaaagttaatacttgatgaaac
Q1XBS8_VBCL2-01         ggaca--------------------------tggatgaggt---------
Q1XBS6_VBCL2-01         ggaca--------------------------tggatgaggt---------
Q1XBS7_VBCL2-01         ggaca--------------------------tggatgaggt---------
Q99D15_VBCL2-01         ggaca--------------------------tggatgaggt---------
Q9WH78_VBCL2-01         ggaca--------------------------tggatgaggt---------
P89884_M11-01           ctgga-----------------------------ttgtgtt---------
B1PZP0_M11-01           ctgga-----------------------------ttgtgtt---------
D0U1R1_M11-01           ctgga-----------------------------ttgctat---------
Q9Q5K8_BHRF1-01         agagaatcacctt---tcagcgtttctcctggcgaccctct---------
Q9WGB5_BHRF1-01         agagaatcacctt---tcagcgtttctcctggcgaccctct---------
Q9IHR2_BHRF1-01         agagaaacacctc---ctcgcgtttccccagaagatactgt---------
A0A0S2YQS0_BHRF1-0      agagaaacacctc---cccgcgtttcgccagaggacactgt---------
A0A2H4Z4F2_BHRF1-0      agagaaacacctc---tccgcctttcaccagaggacactgt---------
A0A0C7TQI4_BHRF1-0      agagaaacacctc---cccgcctttcgccagaggacactgt---------
A0A2S1N164_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A0B6VHG4_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A2H4Z4D6_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A2H4Z4I0_BHRF1-0      agagaaacacctc---cccgcctttcgccagaggacactgt---------
A0A2H4Z4M5_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A2H4Z4H8_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A2H4Z4I4_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A2S1MYK7_BHRF1-0      agagaaacacctc---tctgcctttcaccagaggacactgt---------
A0A2S1MX38_BHRF1-0      agagaaacacctc---tccgcctttcaccagaggacactgt---------
A0A2S1MWX4_BHRF1-0      agagaaacacctc---tccgcctttcaccagaggacactgt---------
A0A2S1MW70_BHRF1-0      agagaaacacctc---tccgcctttcaccagaggacactgt---------
A0A2H4Z4C5_BHRF1-0      agagaaacacctc---tccgcctttcaccagaggacactgt---------
G3CKQ0_BHRF1-01         agagaaacacctc---tccgcctttcaccagaggacactgt---------
A0A0C7U1E2_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A2S1N3G0_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
V5KUE2_BHRF1-02         agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A0C7T306_BHRF1-0      agagaaacacatc---tccgcctttcgccagaggacactgt---------
A0A0C7T6R4_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A0C7T924_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A0X9C4Q9_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A0X8YIW3_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A2H4Z4F8_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A2H4Z4E3_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A2H4Z4D9_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
K9UTF7_BHRF1-01         agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A0C7TWM2_BHRF1-0      agagaaacacctc---tccgccttttgccagaggacactgt---------
A0A2D1LYW3_BHRF1-0      agagaaacacctc---tccgccttttgccagaggacactgt---------
A0A0C7TK05_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
P03182_BHRF1-01         agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A2S1N3U3_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A2S1MNB9_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A2S1MMY2_BHRF1-0      agagaatcacctc---tccgcctttcgccagaggacactgt---------
A0A0S2YRE8_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A0C7TX82_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A0C7TTN2_BHRF1-0      agagaaacacctc---tccacctttcgccagaggacactgt---------
A0A0C7TNT4_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
A0A0C7SXB3_BHRF1-0      agagaaacacctc---tccgcctttcgccagaggacactgt---------
K9UTN7_BHRF1-01         agagaaacacctc---tccgcctttcgccagaggacactgt---------
P0C6Z1_BHRF1-01         agagaaacacctc---tccgcctttcgccagaggacactgt---------
V5KU29_BHRF1-02         agagaaacacctc---tccgcctttcgccagaggacactgt---------
                                                                          

H3ALX7_vNR13-01         ---------gggccggagg-----ccgagctcgg--------ctcggtgc
Q90343_vNR13-01         ---------tggcgcgggc-----cgagccgcgggaggcggcggcgctgc
Q9E1F2_vNR13-01         ---------tagcgagcgg-----cggcacgcaggcagcgttgtcggcgc
Q9E1F2_vNR13-02         ---------tagcgagcgg-----cggcacgcaggcagcgttgtcggcgc
P90504_ORF16-01         ---------gaggccatgt-----tggctaatgtgagatttcacagcacc
F5HGJ3_ORF16-01         ---------gaggccatgt-----tggctaatgtgagatttcacagcacc
Q76RI8_ORF16-01         ---------gaggccatgt-----tggctaatgtgagatttcacagcacc
Q99F66_BALF1-01         ---------ggtcctgtgc-----cggctcat-caaggcctccctc-aga
A0A075FCZ0_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A075FFB0_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A0C7TV67_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A2S1N1Z2_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A2S1N2H2_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A2S1MZQ8_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
U5YUM6_BALF1-01         ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A0U3UKR9_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A2D1LYV4_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
Q91HV2_BALF1-01         ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A0C7TPI3_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A2S1MQV1_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A0C7T8J1_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A2S1MP06_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A2S1MXY9_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A0S2YQW9_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A0C7TJ32_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A2S1MV59_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A2S1MU91_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A2S1MM94_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A0U3U737_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A0C7TLW1_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
K9UT94_BALF1-01         ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
P0CK58_BALF1-01         ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
P0CK59_BALF1-01         ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A0C7TUX3_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
A0A2S1MTH2_BALF1-0      ---------ggtcctctgc-----cggctcat-caaggcctccctg-agg
Q91HI3_BALF1-01         ---------ggtcctgtgc-----cggctgat-taaggcgtccctg-aag
Q99F65_BALF1-01         ---------ggtcctgtgc-----cggctgat-caaggcctccctg-aag
A1BM64_A9-01            ---------ggacctgc----------tttactttaacttcactagagag
Q2VSG7_A9-01            ---------ggacctgc----------tttactttaacttcactagagag
A0A1L2JVL1_A9-01        ccggaagaggggcctcgagtgcagtgggcagtttgaagtcatcagcaact
O36423_A9-01            ccggaagaggggcctcgagtgcagtgggcagtttgaagtcatcagcaact
Q1XBS8_VBCL2-01         ---------ggt-ctccacaatcaggaggctcttg-------gtggaatg
Q1XBS6_VBCL2-01         ---------ggt-ctccacaatcaggaggctcttg-------gtggaatg
Q1XBS7_VBCL2-01         ---------ggt-ctccacaatcaggaggctcttg-------gtggaatg
Q99D15_VBCL2-01         ---------ggt-ctccacaatcaggaggctcttg-------gtggaatg
Q9WH78_VBCL2-01         ---------ggt-ctccacaatcaggaggctcttg-------gtggaatg
P89884_M11-01           ---------gattctgc-------tgtgttagttgatgtctctaaaataa
B1PZP0_M11-01           ---------gattctgc-------tgtgttagttgatgtctctaaaataa
D0U1R1_M11-01           ---------gattcgga-------tgtgttggatgatgtctcgaaaatca
Q9Q5K8_BHRF1-01         ---------ggttctgcgtttacatgcgctacttga------gcagataa
Q9WGB5_BHRF1-01         ---------ggttctgcgtttacatgcgctacttga------gcaaataa
Q9IHR2_BHRF1-01         ---------ggttttgcggttacatttgttgcttga------ggaggtaa
A0A0S2YQS0_BHRF1-0      ---------agtgctgcgttatcatgtgttgcttga------ggagataa
A0A2H4Z4F2_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0C7TQI4_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2S1N164_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0B6VHG4_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2H4Z4D6_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2H4Z4I0_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2H4Z4M5_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2H4Z4H8_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2H4Z4I4_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2S1MYK7_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2S1MX38_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2S1MWX4_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2S1MW70_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2H4Z4C5_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
G3CKQ0_BHRF1-01         ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0C7U1E2_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2S1N3G0_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
V5KUE2_BHRF1-02         ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0C7T306_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0C7T6R4_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0C7T924_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0X9C4Q9_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0X8YIW3_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2H4Z4F8_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2H4Z4E3_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2H4Z4D9_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
K9UTF7_BHRF1-01         ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0C7TWM2_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2D1LYW3_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0C7TK05_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
P03182_BHRF1-01         ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2S1N3U3_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2S1MNB9_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A2S1MMY2_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0S2YRE8_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0C7TX82_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0C7TTN2_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0C7TNT4_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
A0A0C7SXB3_BHRF1-0      ---------agttctgcgttatcatgtgttgcttga------ggagataa
K9UTN7_BHRF1-01         ---------agttctgcgttatcatgtgttgcttga------ggagataa
P0C6Z1_BHRF1-01         ---------agttctgcgttatcatgtgttgcttga------ggagataa
V5KU29_BHRF1-02         ---------agttctgcgttatcatgtgttgcttga------ggagataa
                                                                          

H3ALX7_vNR13-01         tgaagagggtggctg------agcagctggaggcc--gaaggcgg-----
Q90343_vNR13-01         tgcggaaggtggcgg------cgcagctggagacc--gacggcgg-----
Q9E1F2_vNR13-01         tgcaaagtgtggtgt------ctgaattgaactcc--ggaagcgg-----
Q9E1F2_vNR13-02         tgcaaagtgtggtgt------ctgaattgaactcc--ggaagcgg-----
P90504_ORF16-01         accggtataaaccagcttgggttgagcatg-ctgcaggttagcggcgat-
F5HGJ3_ORF16-01         accggtataaaccagcttgggttgagcatg-ctgcaggttagcggcgat-
Q76RI8_ORF16-01         accggtataaaccagcttgggttgagcatg-ctgcaggttagcggcgat-
Q99F66_BALF1-01         aaggacaagaaactg--tacgcggagctggcctgcaagacggcgg-----
A0A075FCZ0_BALF1-0      aaggataggaagctg--tacgcagagctggcctgcaggacagccg-----
A0A075FFB0_BALF1-0      aaggataggaggctg--tacgcagagctggcctgcaggacagccg-----
A0A0C7TV67_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A2S1N1Z2_BALF1-0      aaggataggaagctg--tacacggagctggcctgcaggacagccg-----
A0A2S1N2H2_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A2S1MZQ8_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
U5YUM6_BALF1-01         aaggataggaagctg--tacgcagagctggcctgcaggacagccg-----
A0A0U3UKR9_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A2D1LYV4_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
Q91HV2_BALF1-01         aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A0C7TPI3_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A2S1MQV1_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A0C7T8J1_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A2S1MP06_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A2S1MXY9_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A0S2YQW9_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A0C7TJ32_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A2S1MV59_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A2S1MU91_BALF1-0      aaggatagggagctg--tacgcggagctggcctgcaggacagccg-----
A0A2S1MM94_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A0U3U737_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A0C7TLW1_BALF1-0      aaggataggaagctg--tacgcggacctggcctgcaggacagccg-----
K9UT94_BALF1-01         aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
P0CK58_BALF1-01         aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
P0CK59_BALF1-01         aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A0C7TUX3_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
A0A2S1MTH2_BALF1-0      aaggataggaagctg--tacgcggagctggcctgcaggacagccg-----
Q91HI3_BALF1-01         aaggacaagaagctg--tacgcggagctggcctgcaagacggcgg-----
Q99F65_BALF1-01         aaggacagaaagctg--tacgcggagctggcctgcaagacggcgg-----
A1BM64_A9-01            atacacatgctcctta----taaagagcggcattccctgtagctatgcta
Q2VSG7_A9-01            atacacatgctcctta----taaagagcggcattccctgtagctatgcta
A0A1L2JVL1_A9-01        ctgtagaagcccccgagcctgagtcactggagaggattgcaaaaacact-
O36423_A9-01            ctgtagaagcccccgagcctgagtcactggagaggattgcaaaaacact-
Q1XBS8_VBCL2-01         tggtatgggattggaa----gaatatttagaccatcccgtaacagcccc-
Q1XBS6_VBCL2-01         tggtatgggattggaa----gaatatttagaccatcccgtaacagcccc-
Q1XBS7_VBCL2-01         tggtatgggattggaa----gaatatttagaacaccctgtaacagcccc-
Q99D15_VBCL2-01         tggtatgggattggaa----gaatatttagaacaccctgtaacagcccc-
Q9WH78_VBCL2-01         tggtatgggattggaa----gaatatttagaacaccctgtaacagcccc-
P89884_M11-01           taacattgaccc--ag----gagt--ttagaaggcactatgacagcgtt-
B1PZP0_M11-01           taacattgaccc--ag----gagt--ttagaaggcactatgacagcgtt-
D0U1R1_M11-01           taacattgactc--aa----gagt--tcagaagtcactatgacagtgtc-
Q9Q5K8_BHRF1-01         ttgtccagaatg--ag----gatgcctttgcagagactttggtcacatt-
Q9WGB5_BHRF1-01         ttgtccagaatg--ag----gatgcctttgcagagactttggacagatt-
Q9IHR2_BHRF1-01         ttcagcaaaatg--ca----gaatcatttacaaacacttgggagacatt-
A0A0S2YQS0_BHRF1-0      ttgaacgaaatt--ca----gatacatttacagaaacttgggacagatt-
A0A2H4Z4F2_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0C7TQI4_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2S1N164_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0B6VHG4_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2H4Z4D6_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2H4Z4I0_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2H4Z4M5_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2H4Z4H8_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2H4Z4I4_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2S1MYK7_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2S1MX38_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2S1MWX4_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2S1MW70_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2H4Z4C5_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
G3CKQ0_BHRF1-01         ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0C7U1E2_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2S1N3G0_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
V5KUE2_BHRF1-02         ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0C7T306_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0C7T6R4_BHRF1-0      ttgaacgaaatt--ca----gagacattttcagaaacttggaacagatt-
A0A0C7T924_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0X9C4Q9_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0X8YIW3_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2H4Z4F8_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2H4Z4E3_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagttt-
A0A2H4Z4D9_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
K9UTF7_BHRF1-01         ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0C7TWM2_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2D1LYW3_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0C7TK05_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
P03182_BHRF1-01         ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2S1N3U3_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2S1MNB9_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A2S1MMY2_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0S2YRE8_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0C7TX82_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0C7TTN2_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0C7TNT4_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
A0A0C7SXB3_BHRF1-0      ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
K9UTN7_BHRF1-01         ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
P0C6Z1_BHRF1-01         ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
V5KU29_BHRF1-02         ttgaacgaaatt--ca----gagacatttacagaaacttggaacagatt-
                                                                          

H3ALX7_vNR13-01         ---------ct-------tgaactg-----------------ggggaggg
Q90343_vNR13-01         ---------cc-------tgaactg-----------------gggccggc
Q9E1F2_vNR13-01         ---------ct-------tcaactg-----------------gggtcgat
Q9E1F2_vNR13-02         ---------ct-------tcaactg-----------------gggtcgat
P90504_ORF16-01         ----ggaaaca-------tgaactg-----------------ggggcgag
F5HGJ3_ORF16-01         ----ggaaaca-------tgaactg-----------------ggggcgag
Q76RI8_ORF16-01         ----ggaaaca-------tgaactg-----------------ggggcgag
Q99F66_BALF1-01         --------aca-------t----tg-----------------gaggcaag
A0A075FCZ0_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A075FFB0_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A0C7TV67_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A2S1N1Z2_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A2S1N2H2_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A2S1MZQ8_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
U5YUM6_BALF1-01         --------aca-------t----cg-----------------ggggcaaa
A0A0U3UKR9_BALF1-0      --------aca-------t----ca-----------------ggggcaaa
A0A2D1LYV4_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
Q91HV2_BALF1-01         --------aca-------t----cg-----------------ggggcaaa
A0A0C7TPI3_BALF1-0      --------acg-------t----cg-----------------ggggcaaa
A0A2S1MQV1_BALF1-0      --------acg-------t----cg-----------------ggggcaaa
A0A0C7T8J1_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A2S1MP06_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A2S1MXY9_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A0S2YQW9_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A0C7TJ32_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A2S1MV59_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A2S1MU91_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A2S1MM94_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A0U3U737_BALF1-0      --------aca-------t----cg-----------------gggacaaa
A0A0C7TLW1_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
K9UT94_BALF1-01         --------aca-------t----cg-----------------ggggcaaa
P0CK58_BALF1-01         --------aca-------t----cg-----------------ggggcaaa
P0CK59_BALF1-01         --------aca-------t----cg-----------------ggggcaaa
A0A0C7TUX3_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
A0A2S1MTH2_BALF1-0      --------aca-------t----cg-----------------ggggcaaa
Q91HI3_BALF1-01         --------ata-------t----cg-----------------ggggcaag
Q99F65_BALF1-01         --------aca-------t----tg-----------------ggggcagg
A1BM64_A9-01            aaggcatcatg-------agagctg--------------------ccagg
Q2VSG7_A9-01            aaggcatcatg-------agagccg--------------------ccagg
A0A1L2JVL1_A9-01        ----cttcacaccccgtccacactgggggaggctgg-----------tgg
O36423_A9-01            ----cttcacaccccgtccacactgggggaggctgg-----------tgg
Q1XBS8_VBCL2-01         ----cataaag-------gtggctgtccaggatgtg---atcagaacaaa
Q1XBS6_VBCL2-01         ----cataaag-------gtggctgtccaggatgtg---atcagaacaaa
Q1XBS7_VBCL2-01         ----cataaag-------gtggctgtccaggatgtg---atcagaacaaa
Q99D15_VBCL2-01         ----cataaag-------gtggctgtccaggatgtg---atcagaacaaa
Q9WH78_VBCL2-01         ----cataaag-------gtggctgtccaggatgtg---atcagaacaaa
P89884_M11-01           ----taccgcg-------cggatta---tggccctgccctcaagaactgg
B1PZP0_M11-01           ----taccgcg-------cggatta---tggccctgccctcaagaactgg
D0U1R1_M11-01           ----ttccata-------tggatta---tggccctgcccttcaaaactgg
Q9Q5K8_BHRF1-01         ----tctcttg-------aacactg---aagacctg-------gacctgg
Q9WGB5_BHRF1-01         ----tctcttg-------aacactg---aagacctg-------gacctgg
Q9IHR2_BHRF1-01         ----tataaca-------aacgctg---aacacgtg-------gacctgg
A0A0S2YQS0_BHRF1-0      ----tataaca-------cacaccg---aacatttg-------gacctgg
A0A2H4Z4F2_BHRF1-0      ----tataaca-------cacaccg---aacatttg-------gacctgg
A0A0C7TQI4_BHRF1-0      ----tataaca-------cacaccg---aaaatttg-------gacctgg
A0A2S1N164_BHRF1-0      ----tataaca-------cacaccg---aacatttg-------gacctgg
A0A0B6VHG4_BHRF1-0      ----tataaca-------cacaccg---aaaatttg-------gacctgg
A0A2H4Z4D6_BHRF1-0      ----tataaca-------cacaccg---caaatttg-------gacctgg
A0A2H4Z4I0_BHRF1-0      ----tataaca-------cacaccg---aacatttg-------gacctgg
A0A2H4Z4M5_BHRF1-0      ----tataaca-------cacaccg---aacatttg-------gacctgg
A0A2H4Z4H8_BHRF1-0      ----tataaca-------cacaccg---aacatttg-------gacctgg
A0A2H4Z4I4_BHRF1-0      ----tataaca-------cacaccg---aacatttg-------gacctgg
A0A2S1MYK7_BHRF1-0      ----tataaca-------cacaccg---aacatttg-------gacctgg
A0A2S1MX38_BHRF1-0      ----tttaaca-------cacaccg---aacatttg-------gacctgg
A0A2S1MWX4_BHRF1-0      ----tacaaca-------cacaccg---aacatttg-------gacctgg
A0A2S1MW70_BHRF1-0      ----tataaca-------cacaccg---gacatttg-------gacctgg
A0A2H4Z4C5_BHRF1-0      ----tataaca-------cacaccg---atcatttg-------gacctgg
G3CKQ0_BHRF1-01         ----tataaca-------cacaccg---aacatttg-------gacctgg
A0A0C7U1E2_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A2S1N3G0_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
V5KUE2_BHRF1-02         ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A0C7T306_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A0C7T6R4_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A0C7T924_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A0X9C4Q9_BHRF1-0      ----tataaga-------cacaccg---aacatttg-------gacctgg
A0A0X8YIW3_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A2H4Z4F8_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A2H4Z4E3_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A2H4Z4D9_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
K9UTF7_BHRF1-01         ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A0C7TWM2_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A2D1LYW3_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A0C7TK05_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gatctgg
P03182_BHRF1-01         ----tataaca-------cacaccg---aacatgtg-------gatctgg
A0A2S1N3U3_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A2S1MNB9_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A2S1MMY2_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A0S2YRE8_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A0C7TX82_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A0C7TTN2_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A0C7TNT4_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
A0A0C7SXB3_BHRF1-0      ----tataaca-------cacaccg---aacatgtg-------gacctgg
K9UTN7_BHRF1-01         ----tataaca-------cacaccg---aacatgtg-------gacctgg
P0C6Z1_BHRF1-01         ----tataaca-------cacaccg---aacatgtg-------gacctgg
V5KU29_BHRF1-02         ----tataaca-------cacaccg---aacatgtg-------gacctgg
                                                                          

H3ALX7_vNR13-01         tggtgagtttatttg-ccttcgcgggctgc------ttggc-----taaa
Q90343_vNR13-01         tgctggcgctcgtgg-tgttcgccggcacg------ttggc-----ggca
Q9E1F2_vNR13-01         gcctggcgaccatag-tcctcggcggctcg------ctggc-----aacg
Q9E1F2_vNR13-02         gcctggcgaccatag-tcctcggcggctcg------ctggc-----aacg
P90504_ORF16-01         ccctggc-tatactgacctttggcagtttt------gtg-g-----ccca
F5HGJ3_ORF16-01         ccctggc-tatactgacctttggcagtttt------gtg-g-----ccca
Q76RI8_ORF16-01         ccctggc-tatactgacctttggcagtttt------gtg-g-----ccca
Q99F66_BALF1-01         cacgcccacgtgcagctcatcatcagcatc------ctgcg-----cgcc
A0A075FCZ0_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A075FFB0_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A0C7TV67_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A2S1N1Z2_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A2S1N2H2_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A2S1MZQ8_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
U5YUM6_BALF1-01         gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A0U3UKR9_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A2D1LYV4_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
Q91HV2_BALF1-01         gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A0C7TPI3_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A2S1MQV1_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A0C7T8J1_BALF1-0      gacacgcacgtacggatcatcatcagcgtc------ctgcg-----cgca
A0A2S1MP06_BALF1-0      gacacgcacgtacggatcatcatcagcgtc------ctgcg-----cgca
A0A2S1MXY9_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A0S2YQW9_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A0C7TJ32_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A2S1MV59_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A2S1MU91_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A2S1MM94_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A0U3U737_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A0C7TLW1_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
K9UT94_BALF1-01         gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
P0CK58_BALF1-01         gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
P0CK59_BALF1-01         gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A0C7TUX3_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
A0A2S1MTH2_BALF1-0      gacacgcacgtacggctcatcatcagcgtc------ctgcg-----cgca
Q91HI3_BALF1-01         cacgcgcacgtgcagctcatcatcagcgtc------ctgcg-----cgcc
Q99F65_BALF1-01         cacgctcacgtccagctcatcaccagcgtc------ctgcg-----cgct
A1BM64_A9-01            acaaaagccgtggactgcagctccaccttc---gaggtgat-----agtg
Q2VSG7_A9-01            acaaaagccgtggactgcagctccaccttc---gaggtgat-----agtg
A0A1L2JVL1_A9-01        c-----------------atttctagcatacttggcttatt-----tgca
O36423_A9-01            c-----------------atttctagcatacttggcttatt-----tgca
Q1XBS8_VBCL2-01         acaggacatctttagcaattttttaaca-a------atattaattctgtg
Q1XBS6_VBCL2-01         acaggacatctttagcaattttttaaca-a------atattaattctgtg
Q1XBS7_VBCL2-01         acaggacatctttagcaattttttaaca-a------atattaattctgtg
Q99D15_VBCL2-01         acaggacatctttagcaattttttaaca-a------atattaattctgtg
Q9WH78_VBCL2-01         acaggacatctttagcaattttttaaca-a------atattaattctgtg
P89884_M11-01           aaaagagacctgtccaaacttttcacctcg------ttgtt-----tgta
B1PZP0_M11-01           aaaagagacctgtccaaacttttcacctcg------ttgtt-----tgta
D0U1R1_M11-01           aaagggggcctggctagactttttacctca------ttgtt-----tgga
Q9Q5K8_BHRF1-01         a-------------------tttttccaga------gtgtt-----tgcg
Q9WGB5_BHRF1-01         a-------------------tttttccaga------gtgtt-----tgcg
Q9IHR2_BHRF1-01         a-------------------ttttgccgct------gtatt-----tgaa
A0A0S2YQS0_BHRF1-0      a-------------------ttttaactca------atatt-----ttta
A0A2H4Z4F2_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A0C7TQI4_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2S1N164_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A0B6VHG4_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2H4Z4D6_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2H4Z4I0_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2H4Z4M5_BHRF1-0      a-------------------ttttaactca------gtatt-----tttt
A0A2H4Z4H8_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2H4Z4I4_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2S1MYK7_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2S1MX38_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2S1MWX4_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2S1MW70_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2H4Z4C5_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
G3CKQ0_BHRF1-01         a-------------------ttttaactca------gtatt-----ttta
A0A0C7U1E2_BHRF1-0      a-------------------ttttaattca------gtatt-----ttta
A0A2S1N3G0_BHRF1-0      a-------------------ttttaattca------gtatt-----ttta
V5KUE2_BHRF1-02         a-------------------ttttaattca------gtatt-----ttta
A0A0C7T306_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A0C7T6R4_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A0C7T924_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A0X9C4Q9_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A0X8YIW3_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2H4Z4F8_BHRF1-0      a-------------------ttttaactca------gtatt-----tgta
A0A2H4Z4E3_BHRF1-0      a-------------------ttttaactca------gtatt-----tgta
A0A2H4Z4D9_BHRF1-0      a-------------------ttttaactca------gtatt-----tgta
K9UTF7_BHRF1-01         a-------------------ttttaactca------gtatt-----tgta
A0A0C7TWM2_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2D1LYW3_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A0C7TK05_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
P03182_BHRF1-01         a-------------------ttttaactca------gtatt-----ttta
A0A2S1N3U3_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2S1MNB9_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A2S1MMY2_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A0S2YRE8_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A0C7TX82_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A0C7TTN2_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A0C7TNT4_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
A0A0C7SXB3_BHRF1-0      a-------------------ttttaactca------gtatt-----ttta
K9UTN7_BHRF1-01         a-------------------ttttaactca------gtatt-----ttta
P0C6Z1_BHRF1-01         a-------------------ttttaactca------gtatt-----ttta
V5KU29_BHRF1-02         a-------------------ttttaactca------gtatt-----ttta
                                                             *            

H3ALX7_vNR13-01         ggggtccagcgggcccagaatgaggagtgtgcg------------atggg
Q90343_vNR13-01         g------cgctggccgagagc---gcctgcgag------------gaagg
Q9E1F2_vNR13-01         g------cgctgtacgaaaac---ggctgtgag------------gaagg
Q9E1F2_vNR13-02         g------cgctgtacgaaaac---ggctgtgag------------gaagg
P90504_ORF16-01         gaagt--tatccaacga--acctcacctgcgagactttgctttg------
F5HGJ3_ORF16-01         gaagt--tatccaacga--acctcacctgcgagactttgctttg------
Q76RI8_ORF16-01         gaagt--tatccaacga--acctcacctgcgagactttgctttg------
Q99F66_BALF1-01         g------tgtacgacgaccactacgactactggtcgcggctcagggtggt
A0A075FCZ0_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A075FFB0_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A0C7TV67_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A2S1N1Z2_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A2S1N2H2_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A2S1MZQ8_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
U5YUM6_BALF1-01         g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A0U3UKR9_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A2D1LYV4_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
Q91HV2_BALF1-01         g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A0C7TPI3_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A2S1MQV1_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A0C7T8J1_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A2S1MP06_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A2S1MXY9_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A0S2YQW9_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A0C7TJ32_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A2S1MV59_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A2S1MU91_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A2S1MM94_BALF1-0      t------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A0U3U737_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A0C7TLW1_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
K9UT94_BALF1-01         g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
P0CK58_BALF1-01         g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
P0CK59_BALF1-01         g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A0C7TUX3_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
A0A2S1MTH2_BALF1-0      g------tgtacaacgaccactacgactactggtcgcggctcagggtggt
Q91HI3_BALF1-01         g------tgtacgacgaccactacgactactggtcgcgtctcagggtcgt
Q99F65_BALF1-01         g------tgtacgacgaccactgcgactactggtcgcgtctcagggtggt
A1BM64_A9-01            gatggggtc------ggacacccctctcccgag---tcactggaacggat
Q2VSG7_A9-01            gatggggtc------ggacacccctctcccgag---tcactggaacggat
A0A1L2JVL1_A9-01        gaagaattcaacagagaaactctt-------------------ctggaat
O36423_A9-01            gaagaattcaacagagaaactctt-------------------ctggaat
Q1XBS8_VBCL2-01         gaggattt-------ggagaccctgggc-cacgccatcactacgttaaat
Q1XBS6_VBCL2-01         gaggattt-------ggagaccctgggc-cacgccatcactacgttaaat
Q1XBS7_VBCL2-01         gaggattt-------ggagaccctgggc-cacgccatcactacgttaaat
Q99D15_VBCL2-01         gaagattt-------ggaaaccctgggc-cacgccatcactacgttaaat
Q9WH78_VBCL2-01         gaagattt-------ggaaaccctgggc-catgccatcactacgttaaat
P89884_M11-01           gatgtcatcaacagtggaa-----------------gaattg--ttggat
B1PZP0_M11-01           gatgtcatcaacagtggaa-----------------gaattg--ttggat
D0U1R1_M11-01           gatgccatcaataggggga-----------------gaattg--ttggat
Q9Q5K8_BHRF1-01         gaaatttttcacaatgaagacccaacacttgggcgaggattggcttggct
Q9WGB5_BHRF1-01         gaaatttttcacaatgaagacccaacacttgggcgaggattggcttggct
Q9IHR2_BHRF1-01         gatatatttcaccgtggagatccatcccttgggcgagcgttggcctggct
A0A0S2YQS0_BHRF1-0      gagatatttcaccgtggagacccaagccgtgggcgcgcgttggcctggct
A0A2H4Z4F2_BHRF1-0      gagatatttcaccgtggagaccccagccttgggtgcgcgttgacctggat
A0A0C7TQI4_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2S1N164_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgtgcgttggcctggat
A0A0B6VHG4_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2H4Z4D6_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2H4Z4I0_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2H4Z4M5_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2H4Z4H8_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2H4Z4I4_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2S1MYK7_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2S1MX38_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2S1MWX4_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2S1MW70_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2H4Z4C5_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
G3CKQ0_BHRF1-01         gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A0C7U1E2_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2S1N3G0_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
V5KUE2_BHRF1-02         gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A0C7T306_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A0C7T6R4_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A0C7T924_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A0X9C4Q9_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A0X8YIW3_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2H4Z4F8_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2H4Z4E3_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2H4Z4D9_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
K9UTF7_BHRF1-01         gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A0C7TWM2_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2D1LYW3_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A0C7TK05_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
P03182_BHRF1-01         gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2S1N3U3_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2S1MNB9_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A2S1MMY2_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A0S2YRE8_BHRF1-0      gagatatttcaccgtggagacccaagacttgggcgcgcgttggcctggat
A0A0C7TX82_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A0C7TTN2_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
A0A0C7TNT4_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcacgttggcctggat
A0A0C7SXB3_BHRF1-0      gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
K9UTN7_BHRF1-01         gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
P0C6Z1_BHRF1-01         gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
V5KU29_BHRF1-02         gagatatttcaccgtggagacccaagccttgggcgcgcgttggcctggat
                                                                          

H3ALX7_vNR13-01         agcctgct--------------------gtgggaagttgg----------
Q90343_vNR13-01         gccgagcc--------------------gc------ctgg----------
Q9E1F2_vNR13-01         gccaagcc--------------------gc------ttgg----------
Q9E1F2_vNR13-02         gccaagcc--------------------gc------ttgg----------
P90504_ORF16-01         gccgtttt--------------------ac----ctgtat----------
F5HGJ3_ORF16-01         gccgtttt--------------------ac----ctgtat----------
Q76RI8_ORF16-01         gccgtttt--------------------ac----ctgtat----------
Q99F66_BALF1-01         gctgtgct--------------------acgcggttgtgt----------
A0A075FCZ0_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A075FFB0_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A0C7TV67_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A2S1N1Z2_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A2S1N2H2_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A2S1MZQ8_BALF1-0      gctgtgct--------------------acacagtggtgt----------
U5YUM6_BALF1-01         gctgtgct--------------------acacagtggtgt----------
A0A0U3UKR9_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A2D1LYV4_BALF1-0      gctgtgct--------------------acacagtggtgt----------
Q91HV2_BALF1-01         gctgtgct--------------------acacagtggtgt----------
A0A0C7TPI3_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A2S1MQV1_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A0C7T8J1_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A2S1MP06_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A2S1MXY9_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A0S2YQW9_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A0C7TJ32_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A2S1MV59_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A2S1MU91_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A2S1MM94_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A0U3U737_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A0C7TLW1_BALF1-0      gctgtgct--------------------acacagtggtgt----------
K9UT94_BALF1-01         gctgtgct--------------------acacagtggtgt----------
P0CK58_BALF1-01         gctgtgct--------------------acacagtggtgt----------
P0CK59_BALF1-01         gctgtgct--------------------acacagtggtgt----------
A0A0C7TUX3_BALF1-0      gctgtgct--------------------acacagtggtgt----------
A0A2S1MTH2_BALF1-0      gctgtgct--------------------acacagtggtgt----------
Q91HI3_BALF1-01         gttgtgct--------------------acacggtggtgt----------
Q99F65_BALF1-01         gctgtgct--------------------acacggtggtgt----------
A1BM64_A9-01            agccaagtcgcttttcaccccacggcccaactggggtcgggttgtgatg-
Q2VSG7_A9-01            agccaagtcgctattcaccccacggcccaactggggtcgggttgtgatg-
A0A1L2JVL1_A9-01        gaccactt--------gaaaaaactcaaacaaatagtcaagtg-------
O36423_A9-01            gaccactt--------gaaaaaactcaaacaaatagtcaagtg-------
Q1XBS8_VBCL2-01         gactaccc--------ctccccaaacatgggcagagttgtatgtggcata
Q1XBS6_VBCL2-01         gactatcc--------ctccccaaacatgggcagagttgtatgtggcata
Q1XBS7_VBCL2-01         gactatcc--------ctccccaaacatgggcagagttgtatgtggcata
Q99D15_VBCL2-01         gactatcc--------ctccccaaacatgggcagagttgtatgtggcata
Q9WH78_VBCL2-01         gactatcc--------ctccccaaacatgggcagagttgtatgtggcata
P89884_M11-01           tttttgat--------gttggcagatatg--------tgtgtgaggagg-
B1PZP0_M11-01           tttttgat--------gttggcagatatg--------tgtgtgaggagg-
D0U1R1_M11-01           tttttgat--------gttggaagatatg--------tgtgtgaagagc-
Q9Q5K8_BHRF1-01         ggcctggt--------gcatgcatgcctgcagaactttatgtggtgacac
Q9WGB5_BHRF1-01         ggcctggt--------gcatgcatgcctgcagaactttatgtggtgacac
Q9IHR2_BHRF1-01         ggcctggt--------gtatgcatgcctgcaggacattgtgcaggaacca
A0A0S2YQS0_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A2H4Z4F2_BHRF1-0      ggcctggg--------gcatgcatgcctgttggaccttgtgttgtaacca
A0A0C7TQI4_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A2S1N164_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A0B6VHG4_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A2H4Z4D6_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A2H4Z4I0_BHRF1-0      ggcctggt--------gcatgcatgcctgtaggacattgtgttgtaacca
A0A2H4Z4M5_BHRF1-0      ggcctggt--------gcatgcatgcctgtaggacattgtgttgtaacca
A0A2H4Z4H8_BHRF1-0      ggcctggt--------gcatgcatgcctgtaggacattgtgttgtaacca
A0A2H4Z4I4_BHRF1-0      ggcctggt--------gcatgcatgcctgtaggacattgtgttgtaacca
A0A2S1MYK7_BHRF1-0      ggcctggt--------gcatgcatgcctgtaggacattgtgttgtaacca
A0A2S1MX38_BHRF1-0      ggcctggt--------gcatgcatgcctgtaggacattgtgttgtaacca
A0A2S1MWX4_BHRF1-0      ggcctggt--------gcatgcatgcctgtaggacattgtgttgtaacca
A0A2S1MW70_BHRF1-0      ggcctggt--------gcatgcatgcctgtaggacattgtgttgtaacca
A0A2H4Z4C5_BHRF1-0      ggcctggt--------gcatgcatgcctgtaggacattgtgttgtaacca
G3CKQ0_BHRF1-01         ggcctggt--------gcatgcatgcctgtaggacattgtgttgtaacca
A0A0C7U1E2_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttataacca
A0A2S1N3G0_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
V5KUE2_BHRF1-02         ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A0C7T306_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A0C7T6R4_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A0C7T924_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A0X9C4Q9_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A0X8YIW3_BHRF1-0      ggcctggt--------gcatgcatgcctgcagggcattgtgttgtaacca
A0A2H4Z4F8_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A2H4Z4E3_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A2H4Z4D9_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
K9UTF7_BHRF1-01         ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A0C7TWM2_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A2D1LYW3_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggagattgtgttgtaacca
A0A0C7TK05_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaaccc
P03182_BHRF1-01         ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A2S1N3U3_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A2S1MNB9_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A2S1MMY2_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A0S2YRE8_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A0C7TX82_BHRF1-0      ggcctggt--------gcatgtatgcctgcaggacattgtgttgtaacca
A0A0C7TTN2_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A0C7TNT4_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
A0A0C7SXB3_BHRF1-0      ggcctggt--------gcatgcatgcctgcaggacattgtgttttaacca
K9UTN7_BHRF1-01         ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
P0C6Z1_BHRF1-01         ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
V5KU29_BHRF1-02         ggcctggt--------gcatgcatgcctgcaggacattgtgttgtaacca
                                                                          

H3ALX7_vNR13-01         ------------ctgaagctctggttaactacctggccaaggaaagaggg
Q90343_vNR13-01         ------------ccgccgcgctgaccgcgtacctggccgaggagcaggga
Q9E1F2_vNR13-01         ------------ccgcagcgctggccgcgtacctggccgaagagcagggc
Q9E1F2_vNR13-02         ------------ccgcagcgctggccgcgtacctggccgaagagcagggc
P90504_ORF16-01         ------------atgc-gtatgaagc---aatc-----------------
F5HGJ3_ORF16-01         ------------atgc-gtatgaagc---aatc-----------------
Q76RI8_ORF16-01         ------------atgc-gtatgaagc---aatc-----------------
Q99F66_BALF1-01         ------------ttgcggtgcgaaac---tacctgg--------------
A0A075FCZ0_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A075FFB0_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A0C7TV67_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A2S1N1Z2_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A2S1N2H2_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A2S1MZQ8_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
U5YUM6_BALF1-01         ------------ttgcggtgcgaaac---tacctgg--------------
A0A0U3UKR9_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A2D1LYV4_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
Q91HV2_BALF1-01         ------------ttgcggtgcgaaac---tacctgg--------------
A0A0C7TPI3_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A2S1MQV1_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A0C7T8J1_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A2S1MP06_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A2S1MXY9_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A0S2YQW9_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A0C7TJ32_BALF1-0      ------------ttgcggtgcgaaac---tacctga--------------
A0A2S1MV59_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A2S1MU91_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A2S1MM94_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A0U3U737_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A0C7TLW1_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
K9UT94_BALF1-01         ------------ttgcggtgcgaaac---tacctgg--------------
P0CK58_BALF1-01         ------------ttgcggtgcgaaac---tacctgg--------------
P0CK59_BALF1-01         ------------ttgcggtgcgaaac---tacctgg--------------
A0A0C7TUX3_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
A0A2S1MTH2_BALF1-0      ------------ttgcggtgcgaaac---tacctgg--------------
Q91HI3_BALF1-01         ------------ttgcggtgcgaaac---tacctgg--------------
Q99F65_BALF1-01         ------------ttgcggtgcgaaac---tacctgg--------------
A1BM64_A9-01            ----ttttttgcctatttgttttacctgcaaataagctccacccagaagg
Q2VSG7_A9-01            ----ttttttgcctatttgttttacctgcaaataagctccacccagaagg
A0A1L2JVL1_A9-01        -------ccacatcgtgccctggaccc---------tggga---------
O36423_A9-01            -------ccacatcgtgccctggaccc---------tggga---------
Q1XBS8_VBCL2-01         gcattctctgt-ctatgttgt---ccagactgtgtgtaagagaaaaccac
Q1XBS6_VBCL2-01         gcattctctgt-ctatgttgt---ccagactgtgtgtaagagaaaaccac
Q1XBS7_VBCL2-01         gcattctctgt-ctatgttgt---ccagactgtgtgtaagagaaaaccac
Q99D15_VBCL2-01         gcattttctgt-ctatgttgt---ccagactgtctgtaagaggaaaccac
Q9WH78_VBCL2-01         gcattttctgt-ctatgttgt---ccagactgtctgtaagagaaaaccac
P89884_M11-01           ----------tactatgt------cccggcagttggacgga---------
B1PZP0_M11-01           ----------tactatgt------cccggcagttggacgga---------
D0U1R1_M11-01           ----------tactgtgt------ccaggcagttggacgga---------
Q9Q5K8_BHRF1-01         taactgtccctactatgttgtggacctggcagttcgtggaa---------
Q9WGB5_BHRF1-01         taactgtccctactatgttgtggacctggcagttcgtggaa---------
Q9IHR2_BHRF1-01         gaacactccttactatgttgtggacctgtcagttcgtggga---------
A0A0S2YQS0_BHRF1-0      ggacactccttactatgttgtggacctgtcagttcgtggga---------
A0A2H4Z4F2_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0C7TQI4_BHRF1-0      gtatactccttactatgttgtggacctgtcagttcgtggga---------
A0A2S1N164_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0B6VHG4_BHRF1-0      gtatactccttactatgttgtggacctgtcagttcgtggga---------
A0A2H4Z4D6_BHRF1-0      gtatactccttactatgttgtggacctgtcagttcgtggga---------
A0A2H4Z4I0_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2H4Z4M5_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2H4Z4H8_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2H4Z4I4_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2S1MYK7_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2S1MX38_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2S1MWX4_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2S1MW70_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2H4Z4C5_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
G3CKQ0_BHRF1-01         gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0C7U1E2_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2S1N3G0_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
V5KUE2_BHRF1-02         gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0C7T306_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0C7T6R4_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0C7T924_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0X9C4Q9_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0X8YIW3_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2H4Z4F8_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2H4Z4E3_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2H4Z4D9_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
K9UTF7_BHRF1-01         gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0C7TWM2_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2D1LYW3_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0C7TK05_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
P03182_BHRF1-01         gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2S1N3U3_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2S1MNB9_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A2S1MMY2_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0S2YRE8_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0C7TX82_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0C7TTN2_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0C7TNT4_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
A0A0C7SXB3_BHRF1-0      gtctactccttactatgttgtggacctgtcagttcgtggga---------
K9UTN7_BHRF1-01         gtctactccttactatgttgtggacctgtcagttcgtggga---------
P0C6Z1_BHRF1-01         gtctactccttactatgttgtggacctgtcagttcgtggga---------
V5KU29_BHRF1-02         gtctactccttactatgttgtggacctgtcagttcgtggga---------
                                                                          

H3ALX7_vNR13-01         gactggctggag---------------------------------gagaa
Q90343_vNR13-01         gagtggatggag---------------------------------gagca
Q9E1F2_vNR13-01         gagtggttgcgg---------------------------------gagca
Q9E1F2_vNR13-02         gagtggttgcgg---------------------------------gagca
P90504_ORF16-01         ---ggaccccag---------------------------------tggtt
F5HGJ3_ORF16-01         ---ggaccccag---------------------------------tggtt
Q76RI8_ORF16-01         ---ggaccccag---------------------------------tggtt
Q99F66_BALF1-01         --atgaccacga---------------------------------gagtg
A0A075FCZ0_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A075FFB0_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A0C7TV67_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A2S1N1Z2_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A2S1N2H2_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A2S1MZQ8_BALF1-0      --atgaccacaa---------------------------------gagcg
U5YUM6_BALF1-01         --atgaccacaa---------------------------------gagcg
A0A0U3UKR9_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A2D1LYV4_BALF1-0      --atgaccacaa---------------------------------gagcg
Q91HV2_BALF1-01         --atgaccacaa---------------------------------gagcg
A0A0C7TPI3_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A2S1MQV1_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A0C7T8J1_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A2S1MP06_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A2S1MXY9_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A0S2YQW9_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A0C7TJ32_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A2S1MV59_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A2S1MU91_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A2S1MM94_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A0U3U737_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A0C7TLW1_BALF1-0      --atgaccacaa---------------------------------gagcg
K9UT94_BALF1-01         --atgaccacaa---------------------------------gagcg
P0CK58_BALF1-01         --atgaccacaa---------------------------------gagcg
P0CK59_BALF1-01         --atgaccacaa---------------------------------gagcg
A0A0C7TUX3_BALF1-0      --atgaccacaa---------------------------------gagcg
A0A2S1MTH2_BALF1-0      --atgaccacaa---------------------------------gagcg
Q91HI3_BALF1-01         --atgaccacga---------------------------------gagcg
Q99F65_BALF1-01         --atgaccacag---------------------------------aagtg
A1BM64_A9-01            ttttttttcgggaccattacaagaagattgaaagcatcatag---aggca
Q2VSG7_A9-01            ttttttttcgggaccattacaagaagattgaaagcatcatag---aggca
A0A1L2JVL1_A9-01        ----------------ccgag------------------------agatc
O36423_A9-01            ----------------ccgag------------------------agatc
Q1XBS8_VBCL2-01         tattggtcaggtgctgcctagacatctttacgagagccactgtccaggct
Q1XBS6_VBCL2-01         tattggtcaggtgctgcctagacatctttacgagagccactgtccaggct
Q1XBS7_VBCL2-01         tattggtcaggtgctgcctagacatctttacgagagccactgtccaggct
Q99D15_VBCL2-01         tattggtcaggtgctgcttagacatctttacgagagccactgtccaggct
Q9WH78_VBCL2-01         tattggtcaggtgctgcttagacatctttacgagagccactgtccaggct
P89884_M11-01           ---ggatcatgaattattga-------------------------acgat
B1PZP0_M11-01           ---ggatcatgaattattga-------------------------acgat
D0U1R1_M11-01           ---ggaacatgatttattga-------------------------acgaa
Q9Q5K8_BHRF1-01         ---tg-ttagaagccagcga-------------------------aggtc
Q9WGB5_BHRF1-01         ---tg-ttagaagccagcga-------------------------aggtc
Q9IHR2_BHRF1-01         ---tg-ttggaagccagcga-------------------------aggcc
A0A0S2YQS0_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2H4Z4F2_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A0C7TQI4_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2S1N164_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A0B6VHG4_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2H4Z4D6_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2H4Z4I0_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2H4Z4M5_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2H4Z4H8_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2H4Z4I4_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2S1MYK7_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2S1MX38_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2S1MWX4_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2S1MW70_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2H4Z4C5_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
G3CKQ0_BHRF1-01         ---tg-ttagaagccagcga-------------------------aggcc
A0A0C7U1E2_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2S1N3G0_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
V5KUE2_BHRF1-02         ---tg-ttagaagccagcga-------------------------aggcc
A0A0C7T306_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A0C7T6R4_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A0C7T924_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A0X9C4Q9_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A0X8YIW3_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2H4Z4F8_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2H4Z4E3_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2H4Z4D9_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
K9UTF7_BHRF1-01         ---tg-ttagaagccagcga-------------------------aggcc
A0A0C7TWM2_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2D1LYW3_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A0C7TK05_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
P03182_BHRF1-01         ---tg-ttagaagccagcga-------------------------aggcc
A0A2S1N3U3_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2S1MNB9_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A2S1MMY2_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A0S2YRE8_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A0C7TX82_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A0C7TTN2_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A0C7TNT4_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
A0A0C7SXB3_BHRF1-0      ---tg-ttagaagccagcga-------------------------aggcc
K9UTN7_BHRF1-01         ---tg-ttagaagccagcga-------------------------aggcc
P0C6Z1_BHRF1-01         ---tg-ttagaagccagcga-------------------------aggcc
V5KU29_BHRF1-02         ---tg-ttagaagccagcga-------------------------aggcc
                                                                          

H3ALX7_vNR13-01         tggaggctggg-----atggattctacaaattttttgaaagaagtgatca
Q90343_vNR13-01         cggcggatggg-----atggcttctgtcgcttcttcggcagacatggctc
Q9E1F2_vNR13-01         cggcggatggg-----acggattctgtcgcttcttcgcccgttttggtcc
Q9E1F2_vNR13-02         cggcggatgggtaagcacgg----------------------------ca
P90504_ORF16-01         tcgcgctcg--------cggaggctggcg----ag------gcctgaagg
F5HGJ3_ORF16-01         tcgcgctcg--------cggaggctggcg----ag------gcctgaagg
Q76RI8_ORF16-01         tcgcgctcg--------cggaggctggcg----ag------gcctgaagg
Q99F66_BALF1-01         ccgccttcgtg-----ctgggggccaccgcccact------acctggccc
A0A075FCZ0_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A075FFB0_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A0C7TV67_BALF1-0      ccgccttcgtg-----ctgggggcaatagcccact------acctggccc
A0A2S1N1Z2_BALF1-0      ccgccttcgtg-----ctgggggcaatagcccact------acctggccc
A0A2S1N2H2_BALF1-0      ccgccttcgtg-----ctgggggcaatagcccact------acctggccc
A0A2S1MZQ8_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
U5YUM6_BALF1-01         ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A0U3UKR9_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A2D1LYV4_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
Q91HV2_BALF1-01         ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A0C7TPI3_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A2S1MQV1_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A0C7T8J1_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A2S1MP06_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A2S1MXY9_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A0S2YQW9_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A0C7TJ32_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A2S1MV59_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A2S1MU91_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A2S1MM94_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A0U3U737_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A0C7TLW1_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
K9UT94_BALF1-01         ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
P0CK58_BALF1-01         ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
P0CK59_BALF1-01         ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A0C7TUX3_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
A0A2S1MTH2_BALF1-0      ccgccttcgtg-----ctgggggcaatcgcccact------acctggccc
Q91HI3_BALF1-01         cggccttcgtt-----ctgggggccatcgcccact------acctggccc
Q99F65_BALF1-01         cagccttcgtt-----ctgggggccatcgcccact------acctggccc
A1BM64_A9-01            catatagttcc-----ctggactctctcgcagcggaaactcaaggagcct
Q2VSG7_A9-01            catatagttcc-----ctggactctctcgcagcggaaactcaaggagcct
A0A1L2JVL1_A9-01        caaaaccgaaa-----cagcgtccatt-----tgataaattacctagcgc
O36423_A9-01            caaaaccgaaa-----cagcgtccatt-----tgataaattacctagcgc
Q1XBS8_VBCL2-01         ttgaatgttaa-----ttggtttttgc------aggaaggtgggtggccg
Q1XBS6_VBCL2-01         ttgaatgttaa-----ttggtttttgc------aggaaggtgggtggccg
Q1XBS7_VBCL2-01         ttgaatgttaa-----ttggtttttgc------aggaaggtgggtggccg
Q99D15_VBCL2-01         ttgaatgttaa-----ttggtttttac------aggaaggtgggtggccg
Q9WH78_VBCL2-01         ttgaatgttaa-----ttggtttttac------aggaaggtgggtggccg
P89884_M11-01           tgca----tga-----cacacttttttattgaaaacaatttaatgaacca
B1PZP0_M11-01           tgca----tga-----cacacttttttattgaaaacaatttaatgaacca
D0U1R1_M11-01           taca----tga-----cacagttttttattgaaaacaatttaatgaacta
Q9Q5K8_BHRF1-01         ttga----tgg-----ttggattggtc------aacatgggggctggcct
Q9WGB5_BHRF1-01         ttga----tgg-----ttggattggtc------aacatgggggctggcct
Q9IHR2_BHRF1-01         tgga----tgc-----ttggattcatc------aacagggtggctggact
A0A0S2YQS0_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggtggctggtct
A0A2H4Z4F2_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0C7TQI4_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2S1N164_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0B6VHG4_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2H4Z4D6_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2H4Z4I0_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2H4Z4M5_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2H4Z4H8_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2H4Z4I4_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2S1MYK7_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2S1MX38_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2S1MWX4_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2S1MW70_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2H4Z4C5_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
G3CKQ0_BHRF1-01         tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0C7U1E2_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2S1N3G0_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
V5KUE2_BHRF1-02         tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0C7T306_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0C7T6R4_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0C7T924_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0X9C4Q9_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0X8YIW3_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2H4Z4F8_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2H4Z4E3_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2H4Z4D9_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
K9UTF7_BHRF1-01         tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0C7TWM2_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2D1LYW3_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0C7TK05_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
P03182_BHRF1-01         tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2S1N3U3_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2S1MNB9_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A2S1MMY2_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0S2YRE8_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0C7TX82_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0C7TTN2_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0C7TNT4_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
A0A0C7SXB3_BHRF1-0      tgga----tgg-----ttggattcatc------aacagggcggctggtct
K9UTN7_BHRF1-01         tgga----tgg-----ttggattcatc------aacagggcggctggtct
P0C6Z1_BHRF1-01         tgga----tgg-----ttggattcatc------aacagggcggctggtct
V5KU29_BHRF1-02         tgga----tgg-----ttggattcatc------aacagggcggctggtct
                                                                          

H3ALX7_vNR13-01         t----------------------taccaggagtccactgtacgaaatgct
Q90343_vNR13-01         ccaacca---------gc----tgaccagaacagtaccttaagcaatgct
Q9E1F2_vNR13-01         tgggctg---------gg----agaggcgagtcaaaccttccctcttggt
Q9E1F2_vNR13-02         cgggcgg---------gc----atgagcgg----------ctcgtttgg-
P90504_ORF16-01         cgtattgtacacaggtgc----ttaccagaagaaggggacggagaatgac
F5HGJ3_ORF16-01         cgtattgtacacaggtgc----ttaccagaagaaggggacggagaatgac
Q76RI8_ORF16-01         cgtattgtacacaggtgc----ttaccagaagaaggggacggagaatgac
Q99F66_BALF1-01         tctatcgccgtgtctggt----ttgccaggattggcg------gcctgcc
A0A075FCZ0_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A075FFB0_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A0C7TV67_BALF1-0      tctatcgcagaatctggt----ttgcgaggctgggcg------gcatgcc
A0A2S1N1Z2_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A2S1N2H2_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A2S1MZQ8_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
U5YUM6_BALF1-01         tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A0U3UKR9_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A2D1LYV4_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
Q91HV2_BALF1-01         tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A0C7TPI3_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A2S1MQV1_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A0C7T8J1_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A2S1MP06_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A2S1MXY9_BALF1-0      tctatcgcagaccctggt----ttgcgaggctgggcg------gcatgcc
A0A0S2YQW9_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A0C7TJ32_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A2S1MV59_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A2S1MU91_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A2S1MM94_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A0U3U737_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A0C7TLW1_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
K9UT94_BALF1-01         tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
P0CK58_BALF1-01         tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
P0CK59_BALF1-01         tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A0C7TUX3_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
A0A2S1MTH2_BALF1-0      tctatcgcagactctggt----ttgcgaggctgggcg------gcatgcc
Q91HI3_BALF1-01         tgtaccggagactctggt----ttgcgaggatgggcg------gcatgcc
Q99F65_BALF1-01         tgtaccgcagactctggt----ttgcgaggatgggcg------gcatgcc
A1BM64_A9-01            tttc-------------------cactaaaaatgag--------------
Q2VSG7_A9-01            tttc-------------------cactaaaaatgag--------------
A0A1L2JVL1_A9-01        cttt------------------tatttcttaaccgcagc-----------
O36423_A9-01            cttt------------------tatttcttaaccgcagc-----------
Q1XBS8_VBCL2-01         gctcttgcatcattctgcaaggtggttaatagcccaagcccccgctcca-
Q1XBS6_VBCL2-01         gctcttgcatcattctgcaaggtggttaatagcccaagcccccgctcca-
Q1XBS7_VBCL2-01         gctcttgcatcattctgcaaggtggttaatagcccaagcccccgctcca-
Q99D15_VBCL2-01         gcccttgcatcattctgcaaggtggttaatagcccaagcccccgctcca-
Q9WH78_VBCL2-01         gcccttgcatcattctgcaaggtggttaatagcccaagcccccgctcca-
P89884_M11-01           tttt------------------ccattagaagacatatttttggcacaga
B1PZP0_M11-01           tttt------------------ccattagaagacatatttttggcacaga
D0U1R1_M11-01           tttt------------------tcccttgaagacacattttgtacacaga
Q9Q5K8_BHRF1-01         gctg------------------tcctgagaggcaacccttctggcacca-
Q9WGB5_BHRF1-01         gctg------------------tcctgagaggcaacccttctggcacca-
Q9IHR2_BHRF1-01         ggtc------------------taattaggagcgactctcttggctcca-
A0A0S2YQS0_BHRF1-0      acat------------------taattgaagacaacattcctggctcca-
A0A2H4Z4F2_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A0C7TQI4_BHRF1-0      acat------------------taattgaaaacaacattcctggctcca-
A0A2S1N164_BHRF1-0      acat------------------taattgaagacaactttcctggatcca-
A0A0B6VHG4_BHRF1-0      acat------------------taattgaagacaacattcctggctcca-
A0A2H4Z4D6_BHRF1-0      acat------------------taattgaagacaacattcctggctcca-
A0A2H4Z4I0_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2H4Z4M5_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2H4Z4H8_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2H4Z4I4_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2S1MYK7_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2S1MX38_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2S1MWX4_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2S1MW70_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2H4Z4C5_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
G3CKQ0_BHRF1-01         acat------------------taattgaagacaacattcctggatcca-
A0A0C7U1E2_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2S1N3G0_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
V5KUE2_BHRF1-02         acat------------------taattgaagacaacattcctggatcca-
A0A0C7T306_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A0C7T6R4_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A0C7T924_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A0X9C4Q9_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A0X8YIW3_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2H4Z4F8_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2H4Z4E3_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2H4Z4D9_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
K9UTF7_BHRF1-01         acat------------------taattgaagacaacattcctggatcca-
A0A0C7TWM2_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2D1LYW3_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A0C7TK05_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
P03182_BHRF1-01         acat------------------taattgaagacaacattcctggatcca-
A0A2S1N3U3_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A2S1MNB9_BHRF1-0      acat------------------taattgaagacaacattcctggataca-
A0A2S1MMY2_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A0S2YRE8_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A0C7TX82_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A0C7TTN2_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A0C7TNT4_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
A0A0C7SXB3_BHRF1-0      acat------------------taattgaagacaacattcctggatcca-
K9UTN7_BHRF1-01         acat------------------taattgaagacaacattcctggatcca-
P0C6Z1_BHRF1-01         acat------------------taattgaagacaacattcctggatcca-
V5KU29_BHRF1-02         acat------------------taattgaagacaacattcctggatcca-
                                                                          

H3ALX7_vNR13-01         ttaatgg---------------cag----cagctgggtttggaa------
Q90343_vNR13-01         atcatgg---------------cag----cagcagggtttggaa------
Q9E1F2_vNR13-01         ctcatcg---------------tcgctg-cagccgga-------------
Q9E1F2_vNR13-02         ---gtcg---------------ccggtgtctgccaga-------------
P90504_ORF16-01         agcgctattgggaagcattgcattattggccactatattggcag------
F5HGJ3_ORF16-01         agcgctattgggaagcattgcattattggccactatattggcag------
Q76RI8_ORF16-01         agcgctattgggaagcattgcattattggccactatattggcag------
Q99F66_BALF1-01         caggtcgctgagacgc------caattccctgtaacatgggcta------
A0A075FCZ0_BALF1-0      aagatcgctgaaacgt------cagttccccgtgacgtgggccc------
A0A075FFB0_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A0C7TV67_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A2S1N1Z2_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A2S1N2H2_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A2S1MZQ8_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
U5YUM6_BALF1-01         aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A0U3UKR9_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A2D1LYV4_BALF1-0      aagatcgctgagatgt------cagttccccgtgacgtgggccc------
Q91HV2_BALF1-01         aagatcgctgagatgt------cagttccccgtgacgtgggccc------
A0A0C7TPI3_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A2S1MQV1_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A0C7T8J1_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A2S1MP06_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A2S1MXY9_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A0S2YQW9_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A0C7TJ32_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A2S1MV59_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A2S1MU91_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A2S1MM94_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A0U3U737_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A0C7TLW1_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
K9UT94_BALF1-01         aagatcgctgagacgt------cagttccccgtgacgtgggccc------
P0CK58_BALF1-01         aagatcgctgagacgt------cagttccccgtgacgtgggccc------
P0CK59_BALF1-01         aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A0C7TUX3_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
A0A2S1MTH2_BALF1-0      aagatcgctgagacgt------cagttccccgtgacgtgggccc------
Q91HI3_BALF1-01         aaggtcgctgagacgt------cagttccccgtgagatgggcgc------
Q99F65_BALF1-01         aagatcgctgagacgc------cagttccccgtgacatgggcga------
A1BM64_A9-01            -ggaagt-----------ggttatttttttcaccaca----gtggc---g
Q2VSG7_A9-01            -ggaagt-----------ggttatttttttcaccaca----gtggc---g
A0A1L2JVL1_A9-01        -----------------------agcttcttgtttgacg--ctac-----
O36423_A9-01            -----------------------agcttcttgtttgacg--ctac-----
Q1XBS8_VBCL2-01         -gatggttatttcccatgcttgccatctccggcctggta--ctgactgtg
Q1XBS6_VBCL2-01         -gatggttatttcccatgcttgccatctccggcctggta--ctgactgtg
Q1XBS7_VBCL2-01         -gatggttatttcccatgcttgccatctccggcctggta--ctgactgtg
Q99D15_VBCL2-01         -gatggttatttcccatgtttgccatctccggcctggta--ctgactgtg
Q9WH78_VBCL2-01         -gatggttatttcccatgtttgccatctccggcctggta--ctgactgtg
P89884_M11-01           gaaaattccagaccactggctttacattcttgttgcatgccctggcgaag
B1PZP0_M11-01           gaaaattccagaccactggctttacattcttgttgcatgccctggcgaag
D0U1R1_M11-01           caaaattccataacatgggatttagccttgcattgagtatcctgtgtcgg
Q9Q5K8_BHRF1-01         -gaagctcaag----atggactatcgtttttactgga----ctgacttta
Q9WGB5_BHRF1-01         -gaagctcaag----atggactatcgtttttactgga----ctgacttta
Q9IHR2_BHRF1-01         -caaactctag----atggactttgctttttgccgga----ctgactttg
A0A0S2YQS0_BHRF1-0      -gaagctttag----ctggactttgtttcttgctgga----ctgactttg
A0A2H4Z4F2_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A0C7TQI4_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2S1N164_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A0B6VHG4_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2H4Z4D6_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2H4Z4I0_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2H4Z4M5_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2H4Z4H8_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2H4Z4I4_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2S1MYK7_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2S1MX38_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2S1MWX4_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2S1MW70_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2H4Z4C5_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
G3CKQ0_BHRF1-01         -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A0C7U1E2_BHRF1-0      -gaaggtttag----ctggactttgtttctcgctgga----ctgactttg
A0A2S1N3G0_BHRF1-0      -gaaggtttag----ctggactttgtttctcgctgga----ctgactttg
V5KUE2_BHRF1-02         -gaaggtttag----ctggactttgtttctcgctgga----ctgactttg
A0A0C7T306_BHRF1-0      -gaaggtttag----ctggactttgtttctcgctgga----ctgactttg
A0A0C7T6R4_BHRF1-0      -gaaggtttag----ctggactttgtttctcgctgga----ctgactttg
A0A0C7T924_BHRF1-0      -gaaagtttag----ctggactttgtttctcgctgga----ctgactttg
A0A0X9C4Q9_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A0X8YIW3_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2H4Z4F8_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2H4Z4E3_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2H4Z4D9_BHRF1-0      -gaaggtttat----ctggactttgtttcttgctgga----ctgactttg
K9UTF7_BHRF1-01         -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A0C7TWM2_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2D1LYW3_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A0C7TK05_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
P03182_BHRF1-01         -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2S1N3U3_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2S1MNB9_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A2S1MMY2_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A0S2YRE8_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A0C7TX82_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A0C7TTN2_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A0C7TNT4_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
A0A0C7SXB3_BHRF1-0      -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
K9UTN7_BHRF1-01         -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
P0C6Z1_BHRF1-01         -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
V5KU29_BHRF1-02         -gaaggtttag----ctggactttgtttcttgctgga----ctgactttg
                                                                          

H3ALX7_vNR13-01         --------------------tagcaggtttagccttcctgttagctgtgc
Q90343_vNR13-01         --------------------tagcaggattagcttttctcttggtggtgc
Q9E1F2_vNR13-01         ---------------------atcg-ggataacggttctcatcgtcgtgt
Q9E1F2_vNR13-02         ---------------------agcgaggagcaccgtgcgcggcgctg-gt
P90504_ORF16-01         --------------------cggtcgcgatgagcag------gaga----
F5HGJ3_ORF16-01         --------------------cggtcgcgatgagcag------gaga----
Q76RI8_ORF16-01         --------------------cggtcgcgatgagcag------gaga----
Q99F66_BALF1-01         --------------------tcgccagcctgtcggacttcctgaaatctt
A0A075FCZ0_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A075FFB0_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A0C7TV67_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A2S1N1Z2_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A2S1N2H2_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A2S1MZQ8_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
U5YUM6_BALF1-01         --------------------tggccagcctgactgacttcctgaaatctt
A0A0U3UKR9_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A2D1LYV4_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
Q91HV2_BALF1-01         --------------------tggccagcctgactgacttcctgaaatctt
A0A0C7TPI3_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A2S1MQV1_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A0C7T8J1_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A2S1MP06_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A2S1MXY9_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A0S2YQW9_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A0C7TJ32_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A2S1MV59_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A2S1MU91_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A2S1MM94_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A0U3U737_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A0C7TLW1_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
K9UT94_BALF1-01         --------------------tggccagcctgactgacttcctgaaatctt
P0CK58_BALF1-01         --------------------tggccagcctgactgacttcctgaaatctt
P0CK59_BALF1-01         --------------------tggccagcctgactgacttcctgaaatctt
A0A0C7TUX3_BALF1-0      --------------------tggccagcctgactgacttcctgaaatctt
A0A2S1MTH2_BALF1-0      --------------------tggcaagcctgactgacttcctgaaatctt
Q91HI3_BALF1-01         --------------------tggctggcctgacttacttcctgaaatctt
Q99F65_BALF1-01         --------------------tggccggcctgaccgacttcctgaaatctt
A1BM64_A9-01            tccctggtagcta-------tgcttctgttctgtagacgcgcgtggag--
Q2VSG7_A9-01            tccctggtagcta-------tgcttctgttatgcagacgcgcgtgggg--
A0A1L2JVL1_A9-01        --------------------tgcttctatacttccgaaccactcaaacga
O36423_A9-01            --------------------tgcttctatacttccgaaccactcaaacga
Q1XBS8_VBCL2-01         ggtgtggc------------gagaaacatggtacatttt----------a
Q1XBS6_VBCL2-01         ggtgtggc------------gagaaacatggtacatttt----------a
Q1XBS7_VBCL2-01         ggtgtggc------------gagaaacatggtacatttt----------a
Q99D15_VBCL2-01         ggtgtggc------------tagaaatatggtacatttt----------a
Q9WH78_VBCL2-01         ggtgttgc------------tagaaatatggtacatttt----------a
P89884_M11-01           gtgttgcccaggatatattctgggaatgtgatttatgtc-----------
B1PZP0_M11-01           gtgttgcccaggatatattctgggaatgtgatttatgtc-----------
D0U1R1_M11-01           gcgctgaccaggatatattctggtgatgtgatctatgtc-----------
Q9Q5K8_BHRF1-01         agtttgttagttgtgtg---tagctatat-ctttatttcta---gaagac
Q9WGB5_BHRF1-01         agtttgttagttgtgtg---tagctatat-ctttatttcta---gaagac
Q9IHR2_BHRF1-01         agtctgttaattgtatg---tagctattt-atttatctctagaggaagac
A0A0S2YQS0_BHRF1-0      agtctgttagttgtatg---tagttattt-atttatctccagaggaagac
A0A2H4Z4F2_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0C7TQI4_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2S1N164_BHRF1-0      agtctgttagttatatg---cagttattt-atttatctccagaggaagac
A0A0B6VHG4_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2H4Z4D6_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2H4Z4I0_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2H4Z4M5_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2H4Z4H8_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2H4Z4I4_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2S1MYK7_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2S1MX38_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2S1MWX4_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2S1MW70_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2H4Z4C5_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
G3CKQ0_BHRF1-01         agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0C7U1E2_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2S1N3G0_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
V5KUE2_BHRF1-02         agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0C7T306_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0C7T6R4_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0C7T924_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0X9C4Q9_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0X8YIW3_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2H4Z4F8_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2H4Z4E3_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2H4Z4D9_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
K9UTF7_BHRF1-01         agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0C7TWM2_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2D1LYW3_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0C7TK05_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
P03182_BHRF1-01         agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2S1N3U3_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2S1MNB9_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A2S1MMY2_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0S2YRE8_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0C7TX82_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0C7TTN2_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0C7TNT4_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
A0A0C7SXB3_BHRF1-0      agtctgttagttatatg---tagttattt-atttatctccagaggaagac
K9UTN7_BHRF1-01         agtctgttagttatatg---tagttattt-atttatctccagaggaagac
P0C6Z1_BHRF1-01         agtctgttagttatatg---tagttattt-atttatctccagaggaagac
V5KU29_BHRF1-02         agtctgttagttatatg---tagttattt-atttatctccagaggaagac
                                                                          

H3ALX7_vNR13-01         gataa------------
Q90343_vNR13-01         ggtag------------
Q9E1F2_vNR13-01         ggcaattccaatcctaa
Q9E1F2_vNR13-02         ag---------------
P90504_ORF16-01         --taa------------
F5HGJ3_ORF16-01         --taa------------
Q76RI8_ORF16-01         --taa------------
Q99F66_BALF1-01         tgtaa------------
A0A075FCZ0_BALF1-0      tgtaa------------
A0A075FFB0_BALF1-0      tgtaa------------
A0A0C7TV67_BALF1-0      tgtaa------------
A0A2S1N1Z2_BALF1-0      tgtaa------------
A0A2S1N2H2_BALF1-0      tgtaa------------
A0A2S1MZQ8_BALF1-0      tgtaa------------
U5YUM6_BALF1-01         tgtaa------------
A0A0U3UKR9_BALF1-0      tgtaa------------
A0A2D1LYV4_BALF1-0      tgtaa------------
Q91HV2_BALF1-01         tgtaa------------
A0A0C7TPI3_BALF1-0      tgtaa------------
A0A2S1MQV1_BALF1-0      tgtaa------------
A0A0C7T8J1_BALF1-0      tgtaa------------
A0A2S1MP06_BALF1-0      tgtaa------------
A0A2S1MXY9_BALF1-0      tgtaa------------
A0A0S2YQW9_BALF1-0      tgtaa------------
A0A0C7TJ32_BALF1-0      tgtaa------------
A0A2S1MV59_BALF1-0      tgtaa------------
A0A2S1MU91_BALF1-0      tgtaa------------
A0A2S1MM94_BALF1-0      tgtaa------------
A0A0U3U737_BALF1-0      tgtaa------------
A0A0C7TLW1_BALF1-0      tgtaa------------
K9UT94_BALF1-01         tgtaa------------
P0CK58_BALF1-01         tgtaa------------
P0CK59_BALF1-01         tgtaa------------
A0A0C7TUX3_BALF1-0      tgtaa------------
A0A2S1MTH2_BALF1-0      tgtaa------------
Q91HI3_BALF1-01         tgtaa------------
Q99F65_BALF1-01         tgtaa------------
A1BM64_A9-01            -ctag------------
Q2VSG7_A9-01            -ctag------------
A0A1L2JVL1_A9-01        aatga------------
O36423_A9-01            aatga------------
Q1XBS8_VBCL2-01         cctaa------------
Q1XBS6_VBCL2-01         cctaa------------
Q1XBS7_VBCL2-01         cctaa------------
Q99D15_VBCL2-01         cctaa------------
Q9WH78_VBCL2-01         cctaa------------
P89884_M11-01           --tga------------
B1PZP0_M11-01           --tga------------
D0U1R1_M11-01           --tga------------
Q9Q5K8_BHRF1-01         actaa------------
Q9WGB5_BHRF1-01         actaa------------
Q9IHR2_BHRF1-01         actaa------------
A0A0S2YQS0_BHRF1-0      actaa------------
A0A2H4Z4F2_BHRF1-0      actaa------------
A0A0C7TQI4_BHRF1-0      actaa------------
A0A2S1N164_BHRF1-0      actaa------------
A0A0B6VHG4_BHRF1-0      actaa------------
A0A2H4Z4D6_BHRF1-0      actaa------------
A0A2H4Z4I0_BHRF1-0      actaa------------
A0A2H4Z4M5_BHRF1-0      actaa------------
A0A2H4Z4H8_BHRF1-0      actaa------------
A0A2H4Z4I4_BHRF1-0      actaa------------
A0A2S1MYK7_BHRF1-0      actaa------------
A0A2S1MX38_BHRF1-0      actaa------------
A0A2S1MWX4_BHRF1-0      actaa------------
A0A2S1MW70_BHRF1-0      actaa------------
A0A2H4Z4C5_BHRF1-0      actaa------------
G3CKQ0_BHRF1-01         actaa------------
A0A0C7U1E2_BHRF1-0      actaa------------
A0A2S1N3G0_BHRF1-0      agtaa------------
V5KUE2_BHRF1-02         actaa------------
A0A0C7T306_BHRF1-0      actaa------------
A0A0C7T6R4_BHRF1-0      actaa------------
A0A0C7T924_BHRF1-0      actaa------------
A0A0X9C4Q9_BHRF1-0      actaa------------
A0A0X8YIW3_BHRF1-0      actaa------------
A0A2H4Z4F8_BHRF1-0      actaa------------
A0A2H4Z4E3_BHRF1-0      actaa------------
A0A2H4Z4D9_BHRF1-0      actaa------------
K9UTF7_BHRF1-01         actaa------------
A0A0C7TWM2_BHRF1-0      actaa------------
A0A2D1LYW3_BHRF1-0      actaa------------
A0A0C7TK05_BHRF1-0      actaa------------
P03182_BHRF1-01         actaa------------
A0A2S1N3U3_BHRF1-0      actaa------------
A0A2S1MNB9_BHRF1-0      actaa------------
A0A2S1MMY2_BHRF1-0      actaa------------
A0A0S2YRE8_BHRF1-0      actaa------------
A0A0C7TX82_BHRF1-0      actaa------------
A0A0C7TTN2_BHRF1-0      actaa------------
A0A0C7TNT4_BHRF1-0      actaa------------
A0A0C7SXB3_BHRF1-0      actaa------------
K9UTN7_BHRF1-01         actaa------------
P0C6Z1_BHRF1-01         actaa------------
V5KU29_BHRF1-02         agtaa------------
                                         

© 1998-2019