Dataset for CDS BHRF1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

64 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q9IHR2_BHRF1-01         atggcctattcaacaagggatatactgttagccctgtgtatgcgggacag
A0A0S2YQS0_BHRF1-0      atggcccattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4F2_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A3R5UEL7_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1N164_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4I0_BHRF1-0      atggcctattcaacaagggatatactgttagccctgtgtatacgggacag
A0A3R5X5H4_BHRF1-0      atggcctattcaacaagggatatactgttagccctgtgtatacgggacag
A0A3R5TSC7_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A4D6QZG6_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4C5_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1MW70_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A410IGR6_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1MYK7_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A451G5Y6_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A3R5U6U7_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1MWX4_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1MX38_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A4D6QS84_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A451G617_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A4D6R7N0_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4M5_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4H8_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4I4_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4D6_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0B6VHG4_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7U1E2_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1N3G0_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
V5KUE2_BHRF1-02         atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A4D6TWZ3_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A385J9R2_BHRF1-0      atggcttattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7T924_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7T6R4_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A385J8Q6_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A4D6TV66_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7T306_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A385J7D0_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0X8YIW3_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A3R5TRD4_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A4D6QKL8_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtacacgggacag
A0A385J922_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4F8_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4E3_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4D9_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
K9UTF7_BHRF1-01         atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7TWM2_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2D1LYW3_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7TK05_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
P03182_BHRF1-01         atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A410I865_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A385JAL1_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1MNB9_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7TX82_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1N3U3_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1MMY2_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0S2YRE8_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7TNT4_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7SXB3_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
K9UTN7_BHRF1-01         atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
V5KU29_BHRF1-02         atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0X9C4Q9_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A4D6R3D4_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
Q8UZJ4_BHRF1-01         atggccttttcaacaagagatttactgttagccctgtgtatgcgggacag
Q9Q5K8_BHRF1-01         atggcctattctacaagggatttactgttagctttgtgtatgcgggatgg
Q9WGB5_BHRF1-01         atggcctattctacaagggatttactgttagctttgtgtatgcgggatgg
                        *****   *** ***** **  **********  ******  *****  *

Q9IHR2_BHRF1-01         ttacgtgcatggaaatggatctttgcatcctgtgttggagctagcagcaa
A0A0S2YQS0_BHRF1-0      tcgtgtgcatggaaatggtgtcctgcatcctgtgttggagctagcagcaa
A0A2H4Z4F2_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A3R5UEL7_BHRF1-0      tcgtgtgcatggaaatggtgccctgcatcctgtgttggagctagcagcaa
A0A2S1N164_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4I0_BHRF1-0      tcgtgtgcatggaaatggtgccctgcatcctgtgttggagctagcagcaa
A0A3R5X5H4_BHRF1-0      tcgtgtgcatggaaatggtgccctgcatcctgtgttggagctagcagcaa
A0A3R5TSC7_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A4D6QZG6_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4C5_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2S1MW70_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A410IGR6_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2S1MYK7_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A451G5Y6_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A3R5U6U7_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2S1MWX4_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2S1MX38_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A4D6QS84_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A451G617_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A4D6R7N0_BHRF1-0      tcgtgtgcatggaaatggtcccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4M5_BHRF1-0      tcgtgtgcatggaaatggttccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4H8_BHRF1-0      tcgtgtgcatggaaatgcttccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4I4_BHRF1-0      tcgtgtgcatggaaatggttccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4D6_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0B6VHG4_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7U1E2_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcatcaa
A0A2S1N3G0_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcatcaa
V5KUE2_BHRF1-02         tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcatcaa
A0A4D6TWZ3_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A385J9R2_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7T924_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7T6R4_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A385J8Q6_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A4D6TV66_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7T306_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A385J7D0_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0X8YIW3_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcga
A0A3R5TRD4_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A4D6QKL8_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A385J922_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4F8_BHRF1-0      tcgtgtgcatggaaatggtatcctgcatcctgtgttggagctagcagcaa
A0A2H4Z4E3_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4D9_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
K9UTF7_BHRF1-01         tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7TWM2_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2D1LYW3_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7TK05_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
P03182_BHRF1-01         tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A410I865_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A385JAL1_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2S1MNB9_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7TX82_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2S1N3U3_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcaacaa
A0A2S1MMY2_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0S2YRE8_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7TNT4_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7SXB3_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
K9UTN7_BHRF1-01         tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
V5KU29_BHRF1-02         tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0X9C4Q9_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A4D6R3D4_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
Q8UZJ4_BHRF1-01         tcacgttcatggaaacgagggtctgcatcctgtgttggagttagcatcaa
Q9Q5K8_BHRF1-01         tcacgtttatggaggcgacggtttgcatcctgtgttggagttgacagcaa
Q9WGB5_BHRF1-01         tcacgtttatggaggcgacggtttgcatcctgtgttggagttgacagcaa
                        *   **  *****   *      ***************** *  ** * *

Q9IHR2_BHRF1-01         gagaaacacctcctcgcgtttccccagaagatactgtggttttgcggtta
A0A0S2YQS0_BHRF1-0      gagaaacacctccccgcgtttcgccagaggacactgtagtgctgcgttat
A0A2H4Z4F2_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A3R5UEL7_BHRF1-0      gagaaacacctccccgcctttcgccagaggacactatagttctgcgttat
A0A2S1N164_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4I0_BHRF1-0      gagaaacacctccccgcctttcgccagaggacactgtagttctgcgttat
A0A3R5X5H4_BHRF1-0      gagaaacacctccccgcctttcgccagaggacactgtagttctgcgttat
A0A3R5TSC7_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A4D6QZG6_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A2H4Z4C5_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A2S1MW70_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A410IGR6_BHRF1-0      gagaaacacctctccacctttcaccagaggacactgtagttctgcgttat
A0A2S1MYK7_BHRF1-0      gagaaacacctctctgcctttcaccagaggacactgtagttctgcgttat
A0A451G5Y6_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A3R5U6U7_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A2S1MWX4_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A2S1MX38_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A4D6QS84_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A451G617_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A4D6R7N0_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4M5_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4H8_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4I4_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4D6_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0B6VHG4_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7U1E2_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2S1N3G0_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
V5KUE2_BHRF1-02         gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A4D6TWZ3_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A385J9R2_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7T924_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7T6R4_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A385J8Q6_BHRF1-0      gagaaacacctctctgcctttcgccagaggacactgtagttctgcgttat
A0A4D6TV66_BHRF1-0      gagaaacacgtctctgcctttcgccagaggacactgtagttctgcgttat
A0A0C7T306_BHRF1-0      gagaaacacatctccgcctttcgccagaggacactgtagttctgcgttat
A0A385J7D0_BHRF1-0      gagaaacacttctccgcctttcgccagaggacactgtagttctgcgttat
A0A0X8YIW3_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A3R5TRD4_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A4D6QKL8_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A385J922_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4F8_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4E3_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4D9_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
K9UTF7_BHRF1-01         gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7TWM2_BHRF1-0      gagaaacacctctccgccttttgccagaggacactgtagttctgcgttat
A0A2D1LYW3_BHRF1-0      gagaaacacctctccgccttttgccagaggacactgtagttctgcgttat
A0A0C7TK05_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
P03182_BHRF1-01         gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A410I865_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A385JAL1_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2S1MNB9_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7TX82_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2S1N3U3_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2S1MMY2_BHRF1-0      gagaatcacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0S2YRE8_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7TNT4_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7SXB3_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
K9UTN7_BHRF1-01         gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
V5KU29_BHRF1-02         gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0X9C4Q9_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A4D6R3D4_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
Q8UZJ4_BHRF1-01         gagaatcaccctccagcctctctgcgggggacactctggttctacgtgtc
Q9Q5K8_BHRF1-01         gagaatcacctttcagcgtttctcctggcgaccctctggttctgcgttta
Q9WGB5_BHRF1-01         gagaatcacctttcagcgtttctcctggcgaccctctggttctgcgttta
                        ***** ***       * * *   * *  **  ** * **  * **    

Q9IHR2_BHRF1-01         catttgttgcttgaggaggtaattcagcaaaatgcagaatcatttacaaa
A0A0S2YQS0_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagatacatttacaga
A0A2H4Z4F2_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A3R5UEL7_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1N164_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4I0_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A3R5X5H4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A3R5TSC7_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A4D6QZG6_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4C5_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1MW70_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A410IGR6_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1MYK7_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A451G5Y6_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A3R5U6U7_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1MWX4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1MX38_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A4D6QS84_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A451G617_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A4D6R7N0_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4M5_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4H8_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4I4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4D6_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0B6VHG4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7U1E2_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1N3G0_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
V5KUE2_BHRF1-02         catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A4D6TWZ3_BHRF1-0      catgtgttgctcgaggagataattgaacgaaattcagagacatttacaga
A0A385J9R2_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7T924_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7T6R4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacattttcaga
A0A385J8Q6_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A4D6TV66_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7T306_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A385J7D0_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0X8YIW3_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A3R5TRD4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A4D6QKL8_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A385J922_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4F8_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4E3_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4D9_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
K9UTF7_BHRF1-01         catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7TWM2_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2D1LYW3_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7TK05_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
P03182_BHRF1-01         catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A410I865_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A385JAL1_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1MNB9_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7TX82_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1N3U3_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1MMY2_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0S2YRE8_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7TNT4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7SXB3_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
K9UTN7_BHRF1-01         catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
V5KU29_BHRF1-02         catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0X9C4Q9_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A4D6R3D4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
Q8UZJ4_BHRF1-01         catgtactgcttgagcaaataattgaacaaaatgcgggtgcctttttaga
Q9Q5K8_BHRF1-01         catgcgctacttgagcagataattgtccagaatgaggatgcctttgcaga
Q9WGB5_BHRF1-01         catgcgctacttgagcaaataattgtccagaatgaggatgcctttgcaga
                        ***    * ** *** *  *****   *  ***   *   * ***  * *

Q9IHR2_BHRF1-01         cacttgggagacatttataacaaacgctgaacacgtggacctggattttg
A0A0S2YQS0_BHRF1-0      aacttgggacagatttataacacacaccgaacatttggacctggatttta
A0A2H4Z4F2_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A3R5UEL7_BHRF1-0      aacttggaacagatttataacacacaccgaaaatttggacctggatttta
A0A2S1N164_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A2H4Z4I0_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A3R5X5H4_BHRF1-0      aacttggaacagatttataacacacaccgaaaatttggacctggatttta
A0A3R5TSC7_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A4D6QZG6_BHRF1-0      aacttggaacagatttataacacacaccgaaaatttggacctggatttta
A0A2H4Z4C5_BHRF1-0      aacttggaacagatttataacacacaccgatcatttggacctggatttta
A0A2S1MW70_BHRF1-0      aacttggaacagatttataacacacaccggacatttggacctggatttta
A0A410IGR6_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A2S1MYK7_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A451G5Y6_BHRF1-0      aacttggaacagatttataacatacaccgaacatttggacctggatttta
A0A3R5U6U7_BHRF1-0      aacttggaacagatttatgacacacaccgaacatttggacctggatttta
A0A2S1MWX4_BHRF1-0      aacttggaacagatttacaacacacaccgaacatttggacctggatttta
A0A2S1MX38_BHRF1-0      aacttggaacagatttttaacacacaccgaacatttggacctggatttta
A0A4D6QS84_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A451G617_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A4D6R7N0_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A2H4Z4M5_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A2H4Z4H8_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A2H4Z4I4_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A2H4Z4D6_BHRF1-0      aacttggaacagatttataacacacaccgcaaatttggacctggatttta
A0A0B6VHG4_BHRF1-0      aacttggaacagatttataacacacaccgaaaatttggacctggatttta
A0A0C7U1E2_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A2S1N3G0_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
V5KUE2_BHRF1-02         aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A4D6TWZ3_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A385J9R2_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7T924_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7T6R4_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A385J8Q6_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A4D6TV66_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7T306_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A385J7D0_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0X8YIW3_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A3R5TRD4_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A4D6QKL8_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A385J922_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A2H4Z4F8_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A2H4Z4E3_BHRF1-0      aacttggaacagttttataacacacaccgaacatgtggacctggatttta
A0A2H4Z4D9_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
K9UTF7_BHRF1-01         aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7TWM2_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A2D1LYW3_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7TK05_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggatctggatttta
P03182_BHRF1-01         aacttggaacagatttataacacacaccgaacatgtggatctggatttta
A0A410I865_BHRF1-0      aacttggaacagatttataacacacaccgaacatatggacctggatttta
A0A385JAL1_BHRF1-0      aacttggaacagatttataacatacaccgaacatgtggacctggatttta
A0A2S1MNB9_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7TX82_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A2S1N3U3_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A2S1MMY2_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0S2YRE8_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7TNT4_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7SXB3_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
K9UTN7_BHRF1-01         aacttggaacagatttataacacacaccgaacatgtggacctggatttta
V5KU29_BHRF1-02         aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0X9C4Q9_BHRF1-0      aacttggaacagatttataagacacaccgaacatttggacctggatttta
A0A4D6R3D4_BHRF1-0      aacttggaacagatttataagacacaccgaacatttggacctggatttta
Q8UZJ4_BHRF1-01         agccttggacagatttttatcaaacaccgaagagtgggatgtggatttta
Q9Q5K8_BHRF1-01         gactttggtcacatttctcttgaacactgaagacctggacctggattttt
Q9WGB5_BHRF1-01         gactttggacagatttctcttgaacactgaagacctggacctggattttt
                          * * *   *  ***       ** * *   *   ***  ******** 

Q9IHR2_BHRF1-01         ccgctgtatttgaagatatatttcaccgtggagatccatcccttgggcga
A0A0S2YQS0_BHRF1-0      actcaatatttttagagatatttcaccgtggagacccaagccgtgggcgc
A0A2H4Z4F2_BHRF1-0      actcagtatttttagagatatttcaccgtggagaccccagccttgggtgc
A0A3R5UEL7_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1N164_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgt
A0A2H4Z4I0_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A3R5X5H4_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A3R5TSC7_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A4D6QZG6_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4C5_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1MW70_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A410IGR6_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1MYK7_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A451G5Y6_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A3R5U6U7_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1MWX4_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1MX38_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A4D6QS84_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A451G617_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A4D6R7N0_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4M5_BHRF1-0      actcagtattttttgagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4H8_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4I4_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4D6_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0B6VHG4_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7U1E2_BHRF1-0      attcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1N3G0_BHRF1-0      attcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
V5KUE2_BHRF1-02         attcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A4D6TWZ3_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A385J9R2_BHRF1-0      actcagtatttttagagatatttcaccgtggagrcccaagccttgggcgc
A0A0C7T924_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7T6R4_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A385J8Q6_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A4D6TV66_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7T306_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A385J7D0_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0X8YIW3_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A3R5TRD4_BHRF1-0      actcagtatttgtagagatatttcaccgtggagacccaagccttgggcgc
A0A4D6QKL8_BHRF1-0      actcagtatttgtagagatatttcaccgtggagacccaagccttgggcgc
A0A385J922_BHRF1-0      actcagtatttgtagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4F8_BHRF1-0      actcagtatttgtagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4E3_BHRF1-0      actcagtatttgtagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4D9_BHRF1-0      actcagtatttgtagagatatttcaccgtggagacccaagccttgggcgc
K9UTF7_BHRF1-01         actcagtatttgtagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7TWM2_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2D1LYW3_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7TK05_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
P03182_BHRF1-01         actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A410I865_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A385JAL1_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1MNB9_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7TX82_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1N3U3_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1MMY2_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0S2YRE8_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagacttgggcgc
A0A0C7TNT4_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7SXB3_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
K9UTN7_BHRF1-01         actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
V5KU29_BHRF1-02         actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0X9C4Q9_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A4D6R3D4_BHRF1-0      actcagtatttgtagagatatttcaccgtggagacccaagccttgggcgc
Q8UZJ4_BHRF1-01         ccagagtgtttcaagaaatcttccaccgtggaaatcccactctgggacga
Q9Q5K8_BHRF1-01         ccagagtgtttgcggaaatttttcacaatgaagacccaacacttgggcga
Q9WGB5_BHRF1-01         ccagagtgtttgcggaaatttttcacaatgaagacccaacacttgggcga
                              * ***   ** ** ** ***  ** *   **    *  **  * 

Q9IHR2_BHRF1-01         gcgttggcctggctggcctggtgtatgcatgcctgcaggacattgtgcag
A0A0S2YQS0_BHRF1-0      gcgttggcctggctggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2H4Z4F2_BHRF1-0      gcgttgacctggatggcctggggcatgcatgcctgttggaccttgtgttg
A0A3R5UEL7_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2S1N164_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2H4Z4I0_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A3R5X5H4_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A3R5TSC7_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttc
A0A4D6QZG6_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2H4Z4C5_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2S1MW70_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A410IGR6_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2S1MYK7_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A451G5Y6_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A3R5U6U7_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2S1MWX4_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2S1MX38_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A4D6QS84_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A451G617_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A4D6R7N0_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2H4Z4M5_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2H4Z4H8_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2H4Z4I4_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2H4Z4D6_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0B6VHG4_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7U1E2_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgtta
A0A2S1N3G0_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
V5KUE2_BHRF1-02         gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A4D6TWZ3_BHRF1-0      gcgttggcctggatgncctggtgcatgcatgcctgcaggacattgtgttg
A0A385J9R2_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7T924_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7T6R4_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A385J8Q6_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A4D6TV66_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7T306_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A385J7D0_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0X8YIW3_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcagggcattgtgttg
A0A3R5TRD4_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A4D6QKL8_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A385J922_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2H4Z4F8_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2H4Z4E3_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2H4Z4D9_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
K9UTF7_BHRF1-01         gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7TWM2_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2D1LYW3_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggagattgtgttg
A0A0C7TK05_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
P03182_BHRF1-01         gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A410I865_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A385JAL1_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2S1MNB9_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7TX82_BHRF1-0      gcgttggcctggatggcctggtgcatgtatgcctgcaggacattgtgttg
A0A2S1N3U3_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2S1MMY2_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0S2YRE8_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7TNT4_BHRF1-0      acgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7SXB3_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttt
K9UTN7_BHRF1-01         gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
V5KU29_BHRF1-02         gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0X9C4Q9_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A4D6R3D4_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
Q8UZJ4_BHRF1-01         gcgttggcctggctggcctggtgcatgcatgcctgcaggacgttgtgttg
Q9Q5K8_BHRF1-01         ggattggcttggctggcctggtgcatgcatgcctgcagaactttatgtgg
Q9WGB5_BHRF1-01         ggattggcttggctggcctggtgcatgcatgcctgcagaactttatgtgg
                           *** * *** ** ***** * *** *******  *    ** **   

Q9IHR2_BHRF1-01         gaaccagaacactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0S2YQS0_BHRF1-0      taaccaggacactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4F2_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A3R5UEL7_BHRF1-0      taaccagtatactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1N164_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4I0_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A3R5X5H4_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A3R5TSC7_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A4D6QZG6_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4C5_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1MW70_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A410IGR6_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1MYK7_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A451G5Y6_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A3R5U6U7_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1MWX4_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1MX38_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A4D6QS84_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A451G617_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A4D6R7N0_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4M5_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4H8_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4I4_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4D6_BHRF1-0      taaccagtatactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0B6VHG4_BHRF1-0      taaccagtatactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7U1E2_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1N3G0_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
V5KUE2_BHRF1-02         taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A4D6TWZ3_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A385J9R2_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7T924_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7T6R4_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A385J8Q6_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A4D6TV66_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7T306_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A385J7D0_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0X8YIW3_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A3R5TRD4_BHRF1-0      taaccagtgtactccttactatgttgtggacctgtcagttcgtgggatgt
A0A4D6QKL8_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A385J922_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4F8_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4E3_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4D9_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
K9UTF7_BHRF1-01         taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7TWM2_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2D1LYW3_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7TK05_BHRF1-0      taacccgtctactccttactatgttgtggacctgtcagttcgtgggatgt
P03182_BHRF1-01         taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A410I865_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A385JAL1_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1MNB9_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7TX82_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1N3U3_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1MMY2_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0S2YRE8_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7TNT4_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7SXB3_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
K9UTN7_BHRF1-01         taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
V5KU29_BHRF1-02         taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0X9C4Q9_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A4D6R3D4_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
Q8UZJ4_BHRF1-01         taacaggaatactccctactatgttgtggacctgtcggttcgtgggatgt
Q9Q5K8_BHRF1-01         tgacactaactgtccctactatgttgtggacctggcagttcgtggaatgt
Q9WGB5_BHRF1-01         tgacactaactgtccctactatgttgtggacctggcagttcgtggaatgt
                          **        *** ****************** * ******** ****

Q9IHR2_BHRF1-01         tggaagccagcgaaggcctggatgcttggattcatcaacagggtggctgg
A0A0S2YQS0_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggtggctgg
A0A2H4Z4F2_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A3R5UEL7_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1N164_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4I0_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A3R5X5H4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A3R5TSC7_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A4D6QZG6_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4C5_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1MW70_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A410IGR6_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1MYK7_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A451G5Y6_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A3R5U6U7_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1MWX4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1MX38_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A4D6QS84_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A451G617_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A4D6R7N0_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4M5_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4H8_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4I4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4D6_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0B6VHG4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7U1E2_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1N3G0_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
V5KUE2_BHRF1-02         tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A4D6TWZ3_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A385J9R2_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7T924_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7T6R4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A385J8Q6_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A4D6TV66_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7T306_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A385J7D0_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0X8YIW3_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A3R5TRD4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A4D6QKL8_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A385J922_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4F8_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4E3_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4D9_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
K9UTF7_BHRF1-01         tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7TWM2_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2D1LYW3_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7TK05_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
P03182_BHRF1-01         tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A410I865_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A385JAL1_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1MNB9_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7TX82_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1N3U3_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1MMY2_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0S2YRE8_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7TNT4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7SXB3_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
K9UTN7_BHRF1-01         tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
V5KU29_BHRF1-02         tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0X9C4Q9_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A4D6R3D4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcagctgg
Q8UZJ4_BHRF1-01         tagaagccagcgaaggccttgatgcttggattcaccagcaaggcggctgg
Q9Q5K8_BHRF1-01         tagaagccagcgaaggtcttgatggttggattggtcaacatgggggctgg
Q9WGB5_BHRF1-01         tagaagccagcgaaggtcttgatggttggattggtcaacatgggggctgg
                        * ************** ** **** *******   ** ** **  *****

Q9IHR2_BHRF1-01         actggtctaattaggagcgactctcttggctccacaaactctagatggac
A0A0S2YQS0_BHRF1-0      tctacattaattgaagacaacattcctggctccagaagctttagctggac
A0A2H4Z4F2_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A3R5UEL7_BHRF1-0      tctacattaattgaaaacaacattcctggctccagaaggtttagctggac
A0A2S1N164_BHRF1-0      tctacattaattgaagacaactttcctggatccagaaggtttagctggac
A0A2H4Z4I0_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A3R5X5H4_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A3R5TSC7_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A4D6QZG6_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4C5_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1MW70_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A410IGR6_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1MYK7_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A451G5Y6_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A3R5U6U7_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1MWX4_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1MX38_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A4D6QS84_BHRF1-0      tctacagtaattgaagacaacattcctggatccagaaggtttagctggac
A0A451G617_BHRF1-0      actacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A4D6R7N0_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4M5_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4H8_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4I4_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4D6_BHRF1-0      tctacattaattgaagacaacattcctggctccagaaggtttagctggac
A0A0B6VHG4_BHRF1-0      tctacattaattgaagacaacattcctggctccagaaggtttagctggac
A0A0C7U1E2_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1N3G0_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
V5KUE2_BHRF1-02         tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A4D6TWZ3_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A385J9R2_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7T924_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaagtttagctggac
A0A0C7T6R4_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A385J8Q6_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A4D6TV66_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7T306_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A385J7D0_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0X8YIW3_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A3R5TRD4_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A4D6QKL8_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A385J922_BHRF1-0      tctacattaattgaagacaacattcctggatccagaagttttagctggac
A0A2H4Z4F8_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4E3_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4D9_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttatctggac
K9UTF7_BHRF1-01         tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7TWM2_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2D1LYW3_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7TK05_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
P03182_BHRF1-01         tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A410I865_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A385JAL1_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1MNB9_BHRF1-0      tctacattaattgaagacaacattcctggatacagaaggtttagctggac
A0A0C7TX82_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1N3U3_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1MMY2_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0S2YRE8_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7TNT4_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7SXB3_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
K9UTN7_BHRF1-01         tctacattaattgaagacaacattcctggatccagaaggtttagctggac
V5KU29_BHRF1-02         tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0X9C4Q9_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A4D6R3D4_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
Q8UZJ4_BHRF1-01         ccttctttactgaggggcaaccgttcaaacaccggaagccccatattgac
Q9Q5K8_BHRF1-01         cctgctgtcctgagaggcaacccttctggcaccagaagctcaagatggac
Q9WGB5_BHRF1-01         cctgctgtcctgagaggcaacccttctggcaccagaagctcaagatggac
                         **    *  *      * **  *        *  **     *  * ***

Q9IHR2_BHRF1-01         tttgctttttgccggactgactttgagtctgttaattgtatgtagctatt
A0A0S2YQS0_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttgtatgtagttatt
A0A2H4Z4F2_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A3R5UEL7_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1N164_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgcagttatt
A0A2H4Z4I0_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A3R5X5H4_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A3R5TSC7_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A4D6QZG6_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4C5_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1MW70_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A410IGR6_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1MYK7_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A451G5Y6_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A3R5U6U7_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1MWX4_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1MX38_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A4D6QS84_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A451G617_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A4D6R7N0_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4M5_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4H8_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4I4_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4D6_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0B6VHG4_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7U1E2_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1N3G0_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
V5KUE2_BHRF1-02         tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A4D6TWZ3_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A385J9R2_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7T924_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7T6R4_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A385J8Q6_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A4D6TV66_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7T306_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A385J7D0_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A0X8YIW3_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A3R5TRD4_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A4D6QKL8_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A385J922_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4F8_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4E3_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4D9_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
K9UTF7_BHRF1-01         tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7TWM2_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2D1LYW3_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7TK05_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
P03182_BHRF1-01         tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A410I865_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A385JAL1_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1MNB9_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7TX82_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1N3U3_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1MMY2_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0S2YRE8_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7TNT4_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7SXB3_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
K9UTN7_BHRF1-01         tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
V5KU29_BHRF1-02         tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0X9C4Q9_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A4D6R3D4_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
Q8UZJ4_BHRF1-01         tgcatttttagctggactaactttaactttcgtagttgtgtgtagctatc
Q9Q5K8_BHRF1-01         tatcgtttttactggactgactttaagtttgttagttgtgtgtagctata
Q9WGB5_BHRF1-01         tatcgtttttactggactgactttaagtttgttagttgtgtgtagctata
                        *    ** *  * ***** ***** * * *  ** ** * ** ** *** 

Q9IHR2_BHRF1-01         tatttatctctagaggaagacactaa
A0A0S2YQS0_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4F2_BHRF1-0      tatttatctccagaggaagacactaa
A0A3R5UEL7_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1N164_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4I0_BHRF1-0      tatttatctccagaggaagacactaa
A0A3R5X5H4_BHRF1-0      tatttatctccagaggaagacactaa
A0A3R5TSC7_BHRF1-0      tatttatctccagaggaagacactaa
A0A4D6QZG6_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4C5_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1MW70_BHRF1-0      tatttatctccagaggaagacactaa
A0A410IGR6_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1MYK7_BHRF1-0      tatttatctccagaggaagacactaa
A0A451G5Y6_BHRF1-0      tatttatctccagaggaagacactaa
A0A3R5U6U7_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1MWX4_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1MX38_BHRF1-0      tatttatctccagaggaagacactaa
A0A4D6QS84_BHRF1-0      tatttatctccagaggaagacactaa
A0A451G617_BHRF1-0      tatttatctccagaggaagacactaa
A0A4D6R7N0_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4M5_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4H8_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4I4_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4D6_BHRF1-0      tatttatctccagaggaagacactaa
A0A0B6VHG4_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7U1E2_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1N3G0_BHRF1-0      tatttatctccagaggaagacagtaa
V5KUE2_BHRF1-02         tatttatctccagaggaagacactaa
A0A4D6TWZ3_BHRF1-0      tatttatctccagaggaagacactaa
A0A385J9R2_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7T924_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7T6R4_BHRF1-0      tatttatctccagaggaagacactaa
A0A385J8Q6_BHRF1-0      tatttatctccagaggaagacactaa
A0A4D6TV66_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7T306_BHRF1-0      tatttatctccagaggaagacactaa
A0A385J7D0_BHRF1-0      tatttatctccagaggaagacactaa
A0A0X8YIW3_BHRF1-0      tatttatctccagaggaagacactaa
A0A3R5TRD4_BHRF1-0      tatttatctccagaggaagacactaa
A0A4D6QKL8_BHRF1-0      tatttatctccagaggaagacactaa
A0A385J922_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4F8_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4E3_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4D9_BHRF1-0      tatttatctccagaggaagacactaa
K9UTF7_BHRF1-01         tatttatctccagaggaagacactaa
A0A0C7TWM2_BHRF1-0      tatttatctccagaggaagacactaa
A0A2D1LYW3_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7TK05_BHRF1-0      tatttatctccagaggaagacactaa
P03182_BHRF1-01         tatttatctccagaggaagacactaa
A0A410I865_BHRF1-0      tatttatctccagaggaagacactaa
A0A385JAL1_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1MNB9_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7TX82_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1N3U3_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1MMY2_BHRF1-0      tatttatctccagaggaagacactaa
A0A0S2YRE8_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7TNT4_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7SXB3_BHRF1-0      tatttatctccagaggaagacactaa
K9UTN7_BHRF1-01         tatttatctccagaggaagacactaa
V5KU29_BHRF1-02         tatttatctccagaggaagacagtaa
A0A0X9C4Q9_BHRF1-0      tatttatctccagaggaagacactaa
A0A4D6R3D4_BHRF1-0      tatttatctccagaggaagacactaa
Q8UZJ4_BHRF1-01         tctttatctctggaagaagacgctga
Q9Q5K8_BHRF1-01         tctttatttct---agaagacactaa
Q9WGB5_BHRF1-01         tctttatttct---agaagacactaa
                        * ***** **     ******  * *

© 1998-2019