Dataset for CDS BHRF1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

46 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q9Q5K8_BHRF1-01         atggcctattctacaagggatttactgttagctttgtgtatgcgggatgg
Q9WGB5_BHRF1-01         atggcctattctacaagggatttactgttagctttgtgtatgcgggatgg
Q9IHR2_BHRF1-01         atggcctattcaacaagggatatactgttagccctgtgtatgcgggacag
A0A0S2YQS0_BHRF1-0      atggcccattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4F2_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7TQI4_BHRF1-0      atggcctattcaacaagggatatactgttagccctgtgtatacgggacag
A0A2S1N164_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0B6VHG4_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4D6_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4I0_BHRF1-0      atggcctattcaacaagggatatactgttagccctgtgtatacgggacag
A0A2H4Z4M5_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4H8_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4I4_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1MYK7_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1MX38_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1MWX4_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1MW70_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4C5_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
G3CKQ0_BHRF1-01         atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7U1E2_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1N3G0_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
V5KUE2_BHRF1-02         atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7T306_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7T6R4_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7T924_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0X9C4Q9_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0X8YIW3_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4F8_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4E3_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2H4Z4D9_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
K9UTF7_BHRF1-01         atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7TWM2_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2D1LYW3_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7TK05_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
P03182_BHRF1-01         atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1N3U3_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1MNB9_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A2S1MMY2_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0S2YRE8_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7TX82_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7TTN2_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7TNT4_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
A0A0C7SXB3_BHRF1-0      atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
K9UTN7_BHRF1-01         atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
P0C6Z1_BHRF1-01         atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
V5KU29_BHRF1-02         atggcctattcaacaagggagatactgttagccctgtgtatacgggacag
                        ****** **** ********  **********  ******* *****  *

Q9Q5K8_BHRF1-01         tcacgtttatggaggcgacggtttgcatcctgtgttggagttgacagcaa
Q9WGB5_BHRF1-01         tcacgtttatggaggcgacggtttgcatcctgtgttggagttgacagcaa
Q9IHR2_BHRF1-01         ttacgtgcatggaaatggatctttgcatcctgtgttggagctagcagcaa
A0A0S2YQS0_BHRF1-0      tcgtgtgcatggaaatggtgtcctgcatcctgtgttggagctagcagcaa
A0A2H4Z4F2_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7TQI4_BHRF1-0      tcgtgtgcatggaaatggtgccctgcatcctgtgttggagctagcagcaa
A0A2S1N164_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0B6VHG4_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4D6_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4I0_BHRF1-0      tcgtgtgcatggaaatggtgccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4M5_BHRF1-0      tcgtgtgcatggaaatggttccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4H8_BHRF1-0      tcgtgtgcatggaaatgcttccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4I4_BHRF1-0      tcgtgtgcatggaaatggttccctgcatcctgtgttggagctagcagcaa
A0A2S1MYK7_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2S1MX38_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2S1MWX4_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2S1MW70_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4C5_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
G3CKQ0_BHRF1-01         tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7U1E2_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcatcaa
A0A2S1N3G0_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcatcaa
V5KUE2_BHRF1-02         tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcatcaa
A0A0C7T306_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7T6R4_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7T924_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0X9C4Q9_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0X8YIW3_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcga
A0A2H4Z4F8_BHRF1-0      tcgtgtgcatggaaatggtatcctgcatcctgtgttggagctagcagcaa
A0A2H4Z4E3_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2H4Z4D9_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
K9UTF7_BHRF1-01         tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7TWM2_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2D1LYW3_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7TK05_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
P03182_BHRF1-01         tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2S1N3U3_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcaacaa
A0A2S1MNB9_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A2S1MMY2_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0S2YRE8_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7TX82_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7TTN2_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7TNT4_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
A0A0C7SXB3_BHRF1-0      tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
K9UTN7_BHRF1-01         tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
P0C6Z1_BHRF1-01         tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
V5KU29_BHRF1-02         tcgtgtgcatggaaatggtaccctgcatcctgtgttggagctagcagcaa
                        *   **  *****   *      ***************** *  ** * *

Q9Q5K8_BHRF1-01         gagaatcacctttcagcgtttctcctggcgaccctctggttctgcgttta
Q9WGB5_BHRF1-01         gagaatcacctttcagcgtttctcctggcgaccctctggttctgcgttta
Q9IHR2_BHRF1-01         gagaaacacctcctcgcgtttccccagaagatactgtggttttgcggtta
A0A0S2YQS0_BHRF1-0      gagaaacacctccccgcgtttcgccagaggacactgtagtgctgcgttat
A0A2H4Z4F2_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A0C7TQI4_BHRF1-0      gagaaacacctccccgcctttcgccagaggacactgtagttctgcgttat
A0A2S1N164_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0B6VHG4_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4D6_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4I0_BHRF1-0      gagaaacacctccccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4M5_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4H8_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4I4_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2S1MYK7_BHRF1-0      gagaaacacctctctgcctttcaccagaggacactgtagttctgcgttat
A0A2S1MX38_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A2S1MWX4_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A2S1MW70_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A2H4Z4C5_BHRF1-0      gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
G3CKQ0_BHRF1-01         gagaaacacctctccgcctttcaccagaggacactgtagttctgcgttat
A0A0C7U1E2_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2S1N3G0_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
V5KUE2_BHRF1-02         gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7T306_BHRF1-0      gagaaacacatctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7T6R4_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7T924_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0X9C4Q9_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0X8YIW3_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4F8_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4E3_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2H4Z4D9_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
K9UTF7_BHRF1-01         gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7TWM2_BHRF1-0      gagaaacacctctccgccttttgccagaggacactgtagttctgcgttat
A0A2D1LYW3_BHRF1-0      gagaaacacctctccgccttttgccagaggacactgtagttctgcgttat
A0A0C7TK05_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
P03182_BHRF1-01         gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2S1N3U3_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2S1MNB9_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A2S1MMY2_BHRF1-0      gagaatcacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0S2YRE8_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7TX82_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7TTN2_BHRF1-0      gagaaacacctctccacctttcgccagaggacactgtagttctgcgttat
A0A0C7TNT4_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
A0A0C7SXB3_BHRF1-0      gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
K9UTN7_BHRF1-01         gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
P0C6Z1_BHRF1-01         gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
V5KU29_BHRF1-02         gagaaacacctctccgcctttcgccagaggacactgtagttctgcgttat
                        ***** *** *     * ***  ** *  **  ** * **  **** *  

Q9Q5K8_BHRF1-01         catgcgctacttgagcagataattgtccagaatgaggatgcctttgcaga
Q9WGB5_BHRF1-01         catgcgctacttgagcaaataattgtccagaatgaggatgcctttgcaga
Q9IHR2_BHRF1-01         catttgttgcttgaggaggtaattcagcaaaatgcagaatcatttacaaa
A0A0S2YQS0_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagatacatttacaga
A0A2H4Z4F2_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7TQI4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1N164_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0B6VHG4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4D6_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4I0_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4M5_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4H8_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4I4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1MYK7_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1MX38_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1MWX4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1MW70_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4C5_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
G3CKQ0_BHRF1-01         catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7U1E2_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1N3G0_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
V5KUE2_BHRF1-02         catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7T306_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7T6R4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacattttcaga
A0A0C7T924_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0X9C4Q9_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0X8YIW3_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4F8_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4E3_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2H4Z4D9_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
K9UTF7_BHRF1-01         catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7TWM2_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2D1LYW3_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7TK05_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
P03182_BHRF1-01         catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1N3U3_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1MNB9_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A2S1MMY2_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0S2YRE8_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7TX82_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7TTN2_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7TNT4_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
A0A0C7SXB3_BHRF1-0      catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
K9UTN7_BHRF1-01         catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
P0C6Z1_BHRF1-01         catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
V5KU29_BHRF1-02         catgtgttgcttgaggagataattgaacgaaattcagagacatttacaga
                        ***  * * ****** *  *****   *  ***   **  * *** ** *

Q9Q5K8_BHRF1-01         gactttggtcacatttctcttgaacactgaagacctggacctggattttt
Q9WGB5_BHRF1-01         gactttggacagatttctcttgaacactgaagacctggacctggattttt
Q9IHR2_BHRF1-01         cacttgggagacatttataacaaacgctgaacacgtggacctggattttg
A0A0S2YQS0_BHRF1-0      aacttgggacagatttataacacacaccgaacatttggacctggatttta
A0A2H4Z4F2_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A0C7TQI4_BHRF1-0      aacttggaacagatttataacacacaccgaaaatttggacctggatttta
A0A2S1N164_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A0B6VHG4_BHRF1-0      aacttggaacagatttataacacacaccgaaaatttggacctggatttta
A0A2H4Z4D6_BHRF1-0      aacttggaacagatttataacacacaccgcaaatttggacctggatttta
A0A2H4Z4I0_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A2H4Z4M5_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A2H4Z4H8_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A2H4Z4I4_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A2S1MYK7_BHRF1-0      aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A2S1MX38_BHRF1-0      aacttggaacagatttttaacacacaccgaacatttggacctggatttta
A0A2S1MWX4_BHRF1-0      aacttggaacagatttacaacacacaccgaacatttggacctggatttta
A0A2S1MW70_BHRF1-0      aacttggaacagatttataacacacaccggacatttggacctggatttta
A0A2H4Z4C5_BHRF1-0      aacttggaacagatttataacacacaccgatcatttggacctggatttta
G3CKQ0_BHRF1-01         aacttggaacagatttataacacacaccgaacatttggacctggatttta
A0A0C7U1E2_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A2S1N3G0_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
V5KUE2_BHRF1-02         aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7T306_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7T6R4_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7T924_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0X9C4Q9_BHRF1-0      aacttggaacagatttataagacacaccgaacatttggacctggatttta
A0A0X8YIW3_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A2H4Z4F8_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A2H4Z4E3_BHRF1-0      aacttggaacagttttataacacacaccgaacatgtggacctggatttta
A0A2H4Z4D9_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
K9UTF7_BHRF1-01         aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7TWM2_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A2D1LYW3_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7TK05_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggatctggatttta
P03182_BHRF1-01         aacttggaacagatttataacacacaccgaacatgtggatctggatttta
A0A2S1N3U3_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A2S1MNB9_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A2S1MMY2_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0S2YRE8_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7TX82_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7TTN2_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7TNT4_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
A0A0C7SXB3_BHRF1-0      aacttggaacagatttataacacacaccgaacatgtggacctggatttta
K9UTN7_BHRF1-01         aacttggaacagatttataacacacaccgaacatgtggacctggatttta
P0C6Z1_BHRF1-01         aacttggaacagatttataacacacaccgaacatgtggacctggatttta
V5KU29_BHRF1-02         aacttggaacagatttataacacacaccgaacatgtggacctggatttta
                         **** *   *  ***       ** * *   *  **** ********* 

Q9Q5K8_BHRF1-01         ccagagtgtttgcggaaatttttcacaatgaagacccaacacttgggcga
Q9WGB5_BHRF1-01         ccagagtgtttgcggaaatttttcacaatgaagacccaacacttgggcga
Q9IHR2_BHRF1-01         ccgctgtatttgaagatatatttcaccgtggagatccatcccttgggcga
A0A0S2YQS0_BHRF1-0      actcaatatttttagagatatttcaccgtggagacccaagccgtgggcgc
A0A2H4Z4F2_BHRF1-0      actcagtatttttagagatatttcaccgtggagaccccagccttgggtgc
A0A0C7TQI4_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1N164_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgt
A0A0B6VHG4_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4D6_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4I0_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4M5_BHRF1-0      actcagtattttttgagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4H8_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4I4_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1MYK7_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1MX38_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1MWX4_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1MW70_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4C5_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
G3CKQ0_BHRF1-01         actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7U1E2_BHRF1-0      attcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1N3G0_BHRF1-0      attcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
V5KUE2_BHRF1-02         attcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7T306_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7T6R4_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7T924_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0X9C4Q9_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0X8YIW3_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4F8_BHRF1-0      actcagtatttgtagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4E3_BHRF1-0      actcagtatttgtagagatatttcaccgtggagacccaagccttgggcgc
A0A2H4Z4D9_BHRF1-0      actcagtatttgtagagatatttcaccgtggagacccaagccttgggcgc
K9UTF7_BHRF1-01         actcagtatttgtagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7TWM2_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2D1LYW3_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7TK05_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
P03182_BHRF1-01         actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1N3U3_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1MNB9_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A2S1MMY2_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0S2YRE8_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagacttgggcgc
A0A0C7TX82_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7TTN2_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7TNT4_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
A0A0C7SXB3_BHRF1-0      actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
K9UTN7_BHRF1-01         actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
P0C6Z1_BHRF1-01         actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
V5KU29_BHRF1-02         actcagtatttttagagatatttcaccgtggagacccaagccttgggcgc
                              * ***   ** ** ******  ** *** **    * **** * 

Q9Q5K8_BHRF1-01         ggattggcttggctggcctggtgcatgcatgcctgcagaactttatgtgg
Q9WGB5_BHRF1-01         ggattggcttggctggcctggtgcatgcatgcctgcagaactttatgtgg
Q9IHR2_BHRF1-01         gcgttggcctggctggcctggtgtatgcatgcctgcaggacattgtgcag
A0A0S2YQS0_BHRF1-0      gcgttggcctggctggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2H4Z4F2_BHRF1-0      gcgttgacctggatggcctggggcatgcatgcctgttggaccttgtgttg
A0A0C7TQI4_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2S1N164_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0B6VHG4_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2H4Z4D6_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2H4Z4I0_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2H4Z4M5_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2H4Z4H8_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2H4Z4I4_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2S1MYK7_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2S1MX38_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2S1MWX4_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2S1MW70_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A2H4Z4C5_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
G3CKQ0_BHRF1-01         gcgttggcctggatggcctggtgcatgcatgcctgtaggacattgtgttg
A0A0C7U1E2_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgtta
A0A2S1N3G0_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
V5KUE2_BHRF1-02         gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7T306_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7T6R4_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7T924_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0X9C4Q9_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0X8YIW3_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcagggcattgtgttg
A0A2H4Z4F8_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2H4Z4E3_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2H4Z4D9_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
K9UTF7_BHRF1-01         gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7TWM2_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2D1LYW3_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggagattgtgttg
A0A0C7TK05_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
P03182_BHRF1-01         gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2S1N3U3_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2S1MNB9_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A2S1MMY2_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0S2YRE8_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7TX82_BHRF1-0      gcgttggcctggatggcctggtgcatgtatgcctgcaggacattgtgttg
A0A0C7TTN2_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7TNT4_BHRF1-0      acgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
A0A0C7SXB3_BHRF1-0      gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttt
K9UTN7_BHRF1-01         gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
P0C6Z1_BHRF1-01         gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
V5KU29_BHRF1-02         gcgttggcctggatggcctggtgcatgcatgcctgcaggacattgtgttg
                           *** * *** ******** * *** *******  *    ** **   

Q9Q5K8_BHRF1-01         tgacactaactgtccctactatgttgtggacctggcagttcgtggaatgt
Q9WGB5_BHRF1-01         tgacactaactgtccctactatgttgtggacctggcagttcgtggaatgt
Q9IHR2_BHRF1-01         gaaccagaacactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0S2YQS0_BHRF1-0      taaccaggacactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4F2_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7TQI4_BHRF1-0      taaccagtatactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1N164_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0B6VHG4_BHRF1-0      taaccagtatactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4D6_BHRF1-0      taaccagtatactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4I0_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4M5_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4H8_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4I4_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1MYK7_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1MX38_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1MWX4_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1MW70_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4C5_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
G3CKQ0_BHRF1-01         taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7U1E2_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1N3G0_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
V5KUE2_BHRF1-02         taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7T306_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7T6R4_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7T924_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0X9C4Q9_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0X8YIW3_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4F8_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4E3_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2H4Z4D9_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
K9UTF7_BHRF1-01         taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7TWM2_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2D1LYW3_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7TK05_BHRF1-0      taacccgtctactccttactatgttgtggacctgtcagttcgtgggatgt
P03182_BHRF1-01         taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1N3U3_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1MNB9_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A2S1MMY2_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0S2YRE8_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7TX82_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7TTN2_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7TNT4_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
A0A0C7SXB3_BHRF1-0      taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
K9UTN7_BHRF1-01         taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
P0C6Z1_BHRF1-01         taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
V5KU29_BHRF1-02         taaccagtctactccttactatgttgtggacctgtcagttcgtgggatgt
                          **        *** ****************** ********** ****

Q9Q5K8_BHRF1-01         tagaagccagcgaaggtcttgatggttggattggtcaacatgggggctgg
Q9WGB5_BHRF1-01         tagaagccagcgaaggtcttgatggttggattggtcaacatgggggctgg
Q9IHR2_BHRF1-01         tggaagccagcgaaggcctggatgcttggattcatcaacagggtggctgg
A0A0S2YQS0_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggtggctgg
A0A2H4Z4F2_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7TQI4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1N164_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0B6VHG4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4D6_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4I0_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4M5_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4H8_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4I4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1MYK7_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1MX38_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1MWX4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1MW70_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4C5_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
G3CKQ0_BHRF1-01         tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7U1E2_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1N3G0_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
V5KUE2_BHRF1-02         tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7T306_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7T6R4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7T924_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0X9C4Q9_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0X8YIW3_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4F8_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4E3_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2H4Z4D9_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
K9UTF7_BHRF1-01         tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7TWM2_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2D1LYW3_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7TK05_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
P03182_BHRF1-01         tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1N3U3_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1MNB9_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A2S1MMY2_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0S2YRE8_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7TX82_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7TTN2_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7TNT4_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
A0A0C7SXB3_BHRF1-0      tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
K9UTN7_BHRF1-01         tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
P0C6Z1_BHRF1-01         tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
V5KU29_BHRF1-02         tagaagccagcgaaggcctggatggttggattcatcaacagggcggctgg
                        * ************** ** **** *******  ****** ** ******

Q9Q5K8_BHRF1-01         cctgctgtcctgagaggcaacccttctggcaccagaagctcaagatggac
Q9WGB5_BHRF1-01         cctgctgtcctgagaggcaacccttctggcaccagaagctcaagatggac
Q9IHR2_BHRF1-01         actggtctaattaggagcgactctcttggctccacaaactctagatggac
A0A0S2YQS0_BHRF1-0      tctacattaattgaagacaacattcctggctccagaagctttagctggac
A0A2H4Z4F2_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7TQI4_BHRF1-0      tctacattaattgaaaacaacattcctggctccagaaggtttagctggac
A0A2S1N164_BHRF1-0      tctacattaattgaagacaactttcctggatccagaaggtttagctggac
A0A0B6VHG4_BHRF1-0      tctacattaattgaagacaacattcctggctccagaaggtttagctggac
A0A2H4Z4D6_BHRF1-0      tctacattaattgaagacaacattcctggctccagaaggtttagctggac
A0A2H4Z4I0_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4M5_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4H8_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4I4_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1MYK7_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1MX38_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1MWX4_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1MW70_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4C5_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
G3CKQ0_BHRF1-01         tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7U1E2_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1N3G0_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
V5KUE2_BHRF1-02         tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7T306_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7T6R4_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7T924_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaagtttagctggac
A0A0X9C4Q9_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0X8YIW3_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4F8_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4E3_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2H4Z4D9_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttatctggac
K9UTF7_BHRF1-01         tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7TWM2_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2D1LYW3_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7TK05_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
P03182_BHRF1-01         tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1N3U3_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A2S1MNB9_BHRF1-0      tctacattaattgaagacaacattcctggatacagaaggtttagctggac
A0A2S1MMY2_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0S2YRE8_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7TX82_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7TTN2_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7TNT4_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
A0A0C7SXB3_BHRF1-0      tctacattaattgaagacaacattcctggatccagaaggtttagctggac
K9UTN7_BHRF1-01         tctacattaattgaagacaacattcctggatccagaaggtttagctggac
P0C6Z1_BHRF1-01         tctacattaattgaagacaacattcctggatccagaaggtttagctggac
V5KU29_BHRF1-02         tctacattaattgaagacaacattcctggatccagaaggtttagctggac
                         **    *  *      * **  *  ***   ** **  *  *  *****

Q9Q5K8_BHRF1-01         tatcgtttttactggactgactttaagtttgttagttgtgtgtagctata
Q9WGB5_BHRF1-01         tatcgtttttactggactgactttaagtttgttagttgtgtgtagctata
Q9IHR2_BHRF1-01         tttgctttttgccggactgactttgagtctgttaattgtatgtagctatt
A0A0S2YQS0_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttgtatgtagttatt
A0A2H4Z4F2_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7TQI4_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1N164_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgcagttatt
A0A0B6VHG4_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4D6_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4I0_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4M5_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4H8_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4I4_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1MYK7_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1MX38_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1MWX4_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1MW70_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4C5_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
G3CKQ0_BHRF1-01         tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7U1E2_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1N3G0_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
V5KUE2_BHRF1-02         tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7T306_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7T6R4_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7T924_BHRF1-0      tttgtttctcgctggactgactttgagtctgttagttatatgtagttatt
A0A0X9C4Q9_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0X8YIW3_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4F8_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4E3_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2H4Z4D9_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
K9UTF7_BHRF1-01         tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7TWM2_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2D1LYW3_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7TK05_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
P03182_BHRF1-01         tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1N3U3_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1MNB9_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A2S1MMY2_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0S2YRE8_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7TX82_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7TTN2_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7TNT4_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
A0A0C7SXB3_BHRF1-0      tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
K9UTN7_BHRF1-01         tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
P0C6Z1_BHRF1-01         tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
V5KU29_BHRF1-02         tttgtttcttgctggactgactttgagtctgttagttatatgtagttatt
                        * *  ** *  * *********** *** ***** ** * ** ** *** 

Q9Q5K8_BHRF1-01         tctttatttcta---gaagacactaa
Q9WGB5_BHRF1-01         tctttatttcta---gaagacactaa
Q9IHR2_BHRF1-01         tatttatctctagaggaagacactaa
A0A0S2YQS0_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4F2_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7TQI4_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1N164_BHRF1-0      tatttatctccagaggaagacactaa
A0A0B6VHG4_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4D6_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4I0_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4M5_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4H8_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4I4_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1MYK7_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1MX38_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1MWX4_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1MW70_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4C5_BHRF1-0      tatttatctccagaggaagacactaa
G3CKQ0_BHRF1-01         tatttatctccagaggaagacactaa
A0A0C7U1E2_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1N3G0_BHRF1-0      tatttatctccagaggaagacagtaa
V5KUE2_BHRF1-02         tatttatctccagaggaagacactaa
A0A0C7T306_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7T6R4_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7T924_BHRF1-0      tatttatctccagaggaagacactaa
A0A0X9C4Q9_BHRF1-0      tatttatctccagaggaagacactaa
A0A0X8YIW3_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4F8_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4E3_BHRF1-0      tatttatctccagaggaagacactaa
A0A2H4Z4D9_BHRF1-0      tatttatctccagaggaagacactaa
K9UTF7_BHRF1-01         tatttatctccagaggaagacactaa
A0A0C7TWM2_BHRF1-0      tatttatctccagaggaagacactaa
A0A2D1LYW3_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7TK05_BHRF1-0      tatttatctccagaggaagacactaa
P03182_BHRF1-01         tatttatctccagaggaagacactaa
A0A2S1N3U3_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1MNB9_BHRF1-0      tatttatctccagaggaagacactaa
A0A2S1MMY2_BHRF1-0      tatttatctccagaggaagacactaa
A0A0S2YRE8_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7TX82_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7TTN2_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7TNT4_BHRF1-0      tatttatctccagaggaagacactaa
A0A0C7SXB3_BHRF1-0      tatttatctccagaggaagacactaa
K9UTN7_BHRF1-01         tatttatctccagaggaagacactaa
P0C6Z1_BHRF1-01         tatttatctccagaggaagacactaa
V5KU29_BHRF1-02         tatttatctccagaggaagacagtaa
                        * ***** ** *   ******* ***

© 1998-2018