Dataset for CDS BALF1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

30 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q99F66_BALF1-01         --------------------------------------------------
A0A075FCZ0_BALF1-0      --------------------------------------------------
A0A075FFB0_BALF1-0      --------------------------------------------------
A0A0C7TV67_BALF1-0      --------------------------------------------------
A0A2S1N1Z2_BALF1-0      atgaaccgggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1N2H2_BALF1-0      atgaaccgggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MZQ8_BALF1-0      atgaacctggccattactctggactctcctcacccaggcctcgcgtctta
U5YUM6_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0U3UKR9_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2D1LYV4_BALF1-0      --------------------------------------------------
Q91HV2_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TPI3_BALF1-0      --------------------------------------------------
A0A2S1MQV1_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7T8J1_BALF1-0      --------------------------------------------------
A0A2S1MP06_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MXY9_BALF1-0      atgaacctggccattgctctggactttcctcacccaggcctcgcgtctta
A0A0S2YQW9_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TJ32_BALF1-0      --------------------------------------------------
A0A2S1MV59_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MU91_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MM94_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0U3U737_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TLW1_BALF1-0      --------------------------------------------------
K9UT94_BALF1-01         --------------------------------------------------
P0CK58_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
P0CK59_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TUX3_BALF1-0      --------------------------------------------------
A0A2S1MTH2_BALF1-0      atgaacctggccattgctctggactctcatcacccaggcctcgcgtctta
Q91HI3_BALF1-01         --------------------------------------------------
Q99F65_BALF1-01         --------------------------------------------------
                                                                          

Q99F66_BALF1-01         --------------------------------------------------
A0A075FCZ0_BALF1-0      --------------------------------------------------
A0A075FFB0_BALF1-0      --------------------------------------------------
A0A0C7TV67_BALF1-0      --------------------------------------------------
A0A2S1N1Z2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1N2H2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MZQ8_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
U5YUM6_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0U3UKR9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgaact
A0A2D1LYV4_BALF1-0      --------------------------------------------------
Q91HV2_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TPI3_BALF1-0      --------------------------------------------------
A0A2S1MQV1_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7T8J1_BALF1-0      --------------------------------------------------
A0A2S1MP06_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MXY9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0S2YQW9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TJ32_BALF1-0      --------------------------------------------------
A0A2S1MV59_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MU91_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MM94_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0U3U737_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TLW1_BALF1-0      --------------------------------------------------
K9UT94_BALF1-01         --------------------------------------------------
P0CK58_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
P0CK59_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TUX3_BALF1-0      --------------------------------------------------
A0A2S1MTH2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
Q91HI3_BALF1-01         --------------------------------------------------
Q99F65_BALF1-01         --------------------------------------------------
                                                                          

Q99F66_BALF1-01         --------------atgaaggccgccaagtctacagattcggtgtttgtg
A0A075FCZ0_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A075FFB0_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TV67_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A2S1N1Z2_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1N2H2_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MZQ8_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
U5YUM6_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0U3UKR9_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2D1LYV4_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
Q91HV2_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TPI3_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MQV1_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7T8J1_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MP06_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MXY9_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0S2YQW9_BALF1-0      ggcctgacgagaccatgaggcaagccaagtctacagattctgtgtttgtg
A0A0C7TJ32_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MV59_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MU91_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MM94_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0U3U737_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TLW1_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
K9UT94_BALF1-01         --------------atgaggccagccaagtctacagattctgtgtttgtg
P0CK58_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
P0CK59_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TUX3_BALF1-0      --------------atgaggcaagccaagtctacagattctgtgtttgtg
A0A2S1MTH2_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
Q91HI3_BALF1-01         --------------atgaggccggccaagtctacagattccgtgtttgtg
Q99F65_BALF1-01         --------------atgaggccagccgagtctacagattccgtgtttgtg
                                      **** *   *** ************* *********

Q99F66_BALF1-01         aggaccccggtcgaggcgtgggtctcgccttccccgcccgacgacaaggt
A0A075FCZ0_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A075FFB0_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7TV67_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1N1Z2_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1N2H2_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MZQ8_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
U5YUM6_BALF1-01         aagaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0U3UKR9_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2D1LYV4_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
Q91HV2_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7TPI3_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MQV1_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7T8J1_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MP06_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MXY9_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0S2YQW9_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccatcgccgccggacgacaaggt
A0A0C7TJ32_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MV59_BALF1-0      aggaccccggtcgaggcgtgggtcgcgcccttgccgccggacgacaaggt
A0A2S1MU91_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MM94_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0U3U737_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7TLW1_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
K9UT94_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
P0CK58_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
P0CK59_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7TUX3_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MTH2_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
Q91HI3_BALF1-01         aggaccccagtagaggcgtgggtcgcgccatcgcctccggacgacaaggt
Q99F65_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccgtcgccgccggacgacaaggt
                        * ****** ** ************ **** *  ** ** ***********

Q99F66_BALF1-01         cgcggagaccagctacctcctttttagggccatgtacgcggtgttcaccc
A0A075FCZ0_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A075FFB0_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7TV67_BALF1-0      ggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgccc
A0A2S1N1Z2_BALF1-0      ggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgccc
A0A2S1N2H2_BALF1-0      ggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgccc
A0A2S1MZQ8_BALF1-0      ggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgccc
U5YUM6_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0U3UKR9_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2D1LYV4_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
Q91HV2_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7TPI3_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MQV1_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7T8J1_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MP06_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MXY9_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0S2YQW9_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7TJ32_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MV59_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MU91_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MM94_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0U3U737_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7TLW1_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
K9UT94_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
P0CK58_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
P0CK59_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7TUX3_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MTH2_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
Q91HI3_BALF1-01         ggcggagtccagctacctcatgttcagggcaatgtacgcggtgttcaccc
Q99F65_BALF1-01         ggccgagtccagctacctcatgttcagggcaatgtacgcggtgttctccc
                         ** *** *********** * ** ** ** *************** ***

Q99F66_BALF1-01         aggacgagactgacctgcccaccccagctcaggtcctgtgccggctcatc
A0A075FCZ0_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A075FFB0_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TV67_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1N1Z2_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1N2H2_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MZQ8_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
U5YUM6_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0U3UKR9_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2D1LYV4_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
Q91HV2_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TPI3_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MQV1_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7T8J1_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MP06_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MXY9_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0S2YQW9_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TJ32_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MV59_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MU91_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MM94_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0U3U737_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TLW1_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
K9UT94_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
P0CK58_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
P0CK59_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TUX3_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MTH2_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
Q91HI3_BALF1-01         aggatgagacgggcctgcctctgccagccatggtcctgtgccggctgatt
Q99F65_BALF1-01         gggatgagtcggacctgccgctgccggccgcggtcctgtgccggctgatc
                         *** ***   * ******    ** **   ****** ******** ** 

Q99F66_BALF1-01         aaggcctccctcagaaaggacaagaaactgtacgcggagctggcctgcaa
A0A075FCZ0_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A075FFB0_BALF1-0      aaggcctccctgaggaaggataggaggctgtacgcagagctggcctgcag
A0A0C7TV67_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1N1Z2_BALF1-0      aaggcctccctgaggaaggataggaagctgtacacggagctggcctgcag
A0A2S1N2H2_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1MZQ8_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
U5YUM6_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A0U3UKR9_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2D1LYV4_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
Q91HV2_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7TPI3_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1MQV1_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7T8J1_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1MP06_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1MXY9_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0S2YQW9_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7TJ32_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1MV59_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1MU91_BALF1-0      aaggcctccctgaggaaggatagggagctgtacgcggagctggcctgcag
A0A2S1MM94_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0U3U737_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7TLW1_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggacctggcctgcag
K9UT94_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
P0CK58_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
P0CK59_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7TUX3_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1MTH2_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
Q91HI3_BALF1-01         aaggcgtccctgaagaaggacaagaagctgtacgcggagctggcctgcaa
Q99F65_BALF1-01         aaggcctccctgaagaaggacagaaagctgtacgcggagctggcctgcaa
                        ***** ***** *  ***** *     ****** * ** ********** 

Q99F66_BALF1-01         gacggcggacattggaggcaagcacgcccacgtgcagctcatcatcagca
A0A075FCZ0_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A075FFB0_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7TV67_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1N1Z2_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1N2H2_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1MZQ8_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
U5YUM6_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0U3UKR9_BALF1-0      gacagccgacatcaggggcaaagacacgcacgtacggctcatcatcagcg
A0A2D1LYV4_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
Q91HV2_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7TPI3_BALF1-0      gacagccgacgtcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1MQV1_BALF1-0      gacagccgacgtcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7T8J1_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggatcatcatcagcg
A0A2S1MP06_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggatcatcatcagcg
A0A2S1MXY9_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0S2YQW9_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7TJ32_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1MV59_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1MU91_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1MM94_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0U3U737_BALF1-0      gacagccgacatcggggacaaagacacgcacgtacggctcatcatcagcg
A0A0C7TLW1_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
K9UT94_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
P0CK58_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
P0CK59_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7TUX3_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1MTH2_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
Q91HI3_BALF1-01         gacggcggatatcgggggcaagcacgcgcacgtgcagctcatcatcagcg
Q99F65_BALF1-01         gacggcggacattgggggcaggcacgctcacgtccagctcatcaccagcg
                        *** ** **  *  * * **   ** * ***** * * ****** **** 

Q99F66_BALF1-01         tcctgcgcgccgtgtacgacgaccactacgactactggtcgcggctcagg
A0A075FCZ0_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A075FFB0_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TV67_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1N1Z2_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1N2H2_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MZQ8_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
U5YUM6_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0U3UKR9_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2D1LYV4_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
Q91HV2_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TPI3_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MQV1_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7T8J1_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MP06_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MXY9_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0S2YQW9_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TJ32_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MV59_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MU91_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MM94_BALF1-0      tcctgcgcgcattgtacaacgaccactacgactactggtcgcggctcagg
A0A0U3U737_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TLW1_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
K9UT94_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
P0CK58_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
P0CK59_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TUX3_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MTH2_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
Q91HI3_BALF1-01         tcctgcgcgccgtgtacgacgaccactacgactactggtcgcgtctcagg
Q99F65_BALF1-01         tcctgcgcgctgtgtacgacgaccactgcgactactggtcgcgtctcagg
                        **********  ***** ********* *************** ******

Q99F66_BALF1-01         gtggtgctgtgctacgcggttgtgtttgcggtgcgaaactacctggatga
A0A075FCZ0_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A075FFB0_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TV67_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1N1Z2_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1N2H2_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MZQ8_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
U5YUM6_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0U3UKR9_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2D1LYV4_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
Q91HV2_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TPI3_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MQV1_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7T8J1_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MP06_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MXY9_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0S2YQW9_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TJ32_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctgaatga
A0A2S1MV59_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MU91_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MM94_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0U3U737_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TLW1_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
K9UT94_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
P0CK58_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
P0CK59_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TUX3_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MTH2_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
Q91HI3_BALF1-01         gtcgtgttgtgctacacggtggtgtttgcggtgcgaaactacctggatga
Q99F65_BALF1-01         gtggtgctgtgctacacggtggtgtttgcggtgcgaaactacctggatga
                        ** *** ******** * ** ************************ ****

Q99F66_BALF1-01         ccacgagagtgccgccttcgtgctgggggccaccgcccactacctggccc
A0A075FCZ0_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A075FFB0_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7TV67_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccc
A0A2S1N1Z2_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccc
A0A2S1N2H2_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccc
A0A2S1MZQ8_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
U5YUM6_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0U3UKR9_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2D1LYV4_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
Q91HV2_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7TPI3_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MQV1_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7T8J1_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MP06_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MXY9_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0S2YQW9_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7TJ32_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MV59_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MU91_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MM94_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0U3U737_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7TLW1_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
K9UT94_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
P0CK58_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
P0CK59_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7TUX3_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MTH2_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
Q91HI3_BALF1-01         ccacgagagcgcggccttcgttctgggggccatcgcccactacctggccc
Q99F65_BALF1-01         ccacagaagtgcagccttcgttctgggggccatcgcccactacctggccc
                        ****   ** ** ******** ******** *  ****************

Q99F66_BALF1-01         tctatcgccgtgtctggtttgccaggattggcggcctgcccaggtcgctg
A0A075FCZ0_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A075FFB0_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TV67_BALF1-0      tctatcgcagaatctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1N1Z2_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1N2H2_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MZQ8_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
U5YUM6_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0U3UKR9_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2D1LYV4_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
Q91HV2_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TPI3_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MQV1_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7T8J1_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MP06_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MXY9_BALF1-0      tctatcgcagaccctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0S2YQW9_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TJ32_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MV59_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MU91_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MM94_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0U3U737_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TLW1_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
K9UT94_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
P0CK58_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
P0CK59_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TUX3_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MTH2_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
Q91HI3_BALF1-01         tgtaccggagactctggtttgcgaggatgggcggcatgccaaggtcgctg
Q99F65_BALF1-01         tgtaccgcagactctggtttgcgaggatgggcggcatgccaagatcgctg
                        * ** **  *   ********* *** * ****** **** ** ******

Q99F66_BALF1-01         agacgccaattccctgtaacatgggctatcgccagcctgtcggacttcct
A0A075FCZ0_BALF1-0      aaacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A075FFB0_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TV67_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1N1Z2_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1N2H2_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MZQ8_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
U5YUM6_BALF1-01         agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0U3UKR9_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2D1LYV4_BALF1-0      agatgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
Q91HV2_BALF1-01         agatgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TPI3_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MQV1_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7T8J1_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MP06_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MXY9_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0S2YQW9_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TJ32_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MV59_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MU91_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MM94_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0U3U737_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TLW1_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
K9UT94_BALF1-01         agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
P0CK58_BALF1-01         agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
P0CK59_BALF1-01         agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TUX3_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MTH2_BALF1-0      agacgtcagttccccgtgacgtgggccctggcaagcctgactgacttcct
Q91HI3_BALF1-01         agacgtcagttccccgtgagatgggcgctggctggcctgacttacttcct
Q99F65_BALF1-01         agacgccagttccccgtgacatgggcgatggccggcctgaccgacttcct
                        * * * ** ***** ** *  *****  * **  ***** *  *******

Q99F66_BALF1-01         gaaatctttgtaa
A0A075FCZ0_BALF1-0      gaaatctttgtaa
A0A075FFB0_BALF1-0      gaaatctttgtaa
A0A0C7TV67_BALF1-0      gaaatctttgtaa
A0A2S1N1Z2_BALF1-0      gaaatctttgtaa
A0A2S1N2H2_BALF1-0      gaaatctttgtaa
A0A2S1MZQ8_BALF1-0      gaaatctttgtaa
U5YUM6_BALF1-01         gaaatctttgtaa
A0A0U3UKR9_BALF1-0      gaaatctttgtaa
A0A2D1LYV4_BALF1-0      gaaatctttgtaa
Q91HV2_BALF1-01         gaaatctttgtaa
A0A0C7TPI3_BALF1-0      gaaatctttgtaa
A0A2S1MQV1_BALF1-0      gaaatctttgtaa
A0A0C7T8J1_BALF1-0      gaaatctttgtaa
A0A2S1MP06_BALF1-0      gaaatctttgtaa
A0A2S1MXY9_BALF1-0      gaaatctttgtaa
A0A0S2YQW9_BALF1-0      gaaatctttgtaa
A0A0C7TJ32_BALF1-0      gaaatctttgtaa
A0A2S1MV59_BALF1-0      gaaatctttgtaa
A0A2S1MU91_BALF1-0      gaaatctttgtaa
A0A2S1MM94_BALF1-0      gaaatctttgtaa
A0A0U3U737_BALF1-0      gaaatctttgtaa
A0A0C7TLW1_BALF1-0      gaaatctttgtaa
K9UT94_BALF1-01         gaaatctttgtaa
P0CK58_BALF1-01         gaaatctttgtaa
P0CK59_BALF1-01         gaaatctttgtaa
A0A0C7TUX3_BALF1-0      gaaatctttgtaa
A0A2S1MTH2_BALF1-0      gaaatctttgtaa
Q91HI3_BALF1-01         gaaatctttgtaa
Q99F65_BALF1-01         gaaatctttgtaa
                        *************

© 1998-2018