Dataset for CDS A9 of organism Ovine gammaherpesvirus 2

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A1BM64_A9-01      atggtggaagctggcatactatcaaggaaagtaaccactgggagccactggactttcttc
Q2VSG7_A9-01      atggtggaagctggcatactatcaaggaaagtaaccactgggagccactggactttcttc

A1BM64_A9-01      acccctcaaaccttgaagaaaggggcttgcctgtggaaggctggggcagtatatttcccc
Q2VSG7_A9-01      accccccaaaccttgaagaaaggggcttgtctgtggaaggctggggcagtatatttcccc
                  ***** *********************** ******************************

A1BM64_A9-01      ccagcaagcatgccccccaggaaggcattcaatgacggggacctgctttactttaacttc
Q2VSG7_A9-01      ccagtaagcatgccccccaggaaggcattcaatgacggggacctgctttactttaacttc
                  **** *******************************************************

A1BM64_A9-01      actagagagatacacatgctccttataaagagcggcattccctgtagctatgctaaaggc
Q2VSG7_A9-01      actagagagatacacatgctccttataaagagcggcattccctgtagctatgctaaaggc

A1BM64_A9-01      atcatgagagctgccaggacaaaagccgtggactgcagctccaccttcgaggtgatagtg
Q2VSG7_A9-01      atcatgagagccgccaggacaaaagccgtggactgcagctccaccttcgaggtgatagtg
                  *********** ************************************************

A1BM64_A9-01      gatggggtcggacacccctctcccgagtcactggaacggatagccaagtcgcttttcacc
Q2VSG7_A9-01      gatggggtcggacacccctctcccgagtcactggaacggatagccaagtcgctattcacc
                  ***************************************************** ******

A1BM64_A9-01      ccacggcccaactggggtcgggttgtgatgttttttgcctatttgttttacctgcaaata
Q2VSG7_A9-01      ccacggcccaactggggtcgggttgtgatgttttttgcctatttgttttacctgcaaata

A1BM64_A9-01      agctccacccagaaggttttttttcgggaccattacaagaagattgaaagcatcatagag
Q2VSG7_A9-01      agctccacccagaaggttttttttcgggaccattacaagaagattgaaagcatcatagag

A1BM64_A9-01      gcacatatagttccctggactctctcgcagcggaaactcaaggagccttttccactaaaa
Q2VSG7_A9-01      gcacatatagttccctggactctctcgcagcggaaactcaaggagccttttccactaaaa

A1BM64_A9-01      atgagggaagtggttatttttttcaccacagtggcgtccctggtagctatgcttctgttc
Q2VSG7_A9-01      atgagggaagtggttatttttttcaccacagtggcgtccctggtagctatgcttctgtta

A1BM64_A9-01      tgtagacgcgcgtggagctag
Q2VSG7_A9-01      tgcagacgcgcgtggggctag
                  ** ************ *****

© 1998-2019