Dataset for CDS vNR13 of organism Meleagrid herpesvirus 1

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q9E1F2_vNR13-01      atggctgactccctgaaggaagaaacggcgttgctgctggaggattactt
Q9E1F2_vNR13-02      atggctgactccctgaaggaagaaacggcgttgctgctggaggattactt
                     **************************************************

Q9E1F2_vNR13-01      ccagcactgctgcggcaaggaagggccgccgccgagtcctacggcggcag
Q9E1F2_vNR13-02      ccagcactgctgcggcaaggaagggccgccgccgagtcctacggcggcag
                     **************************************************

Q9E1F2_vNR13-01      agctgcggcgagcggcggccgagctggagcggcgagagaggcccttcttt
Q9E1F2_vNR13-02      agctgcggcgagcggcggccgagctggagcggcgagagaggcccttcttt
                     **************************************************

Q9E1F2_vNR13-01      cgctcctgcgcgccgttagcgagcggcggcacgcaggcagcgttgtcggc
Q9E1F2_vNR13-02      cgctcctgcgcgccgttagcgagcggcggcacgcaggcagcgttgtcggc
                     **************************************************

Q9E1F2_vNR13-01      gctgcaaagtgtggtgtctgaattgaactccggaagcggcttcaactggg
Q9E1F2_vNR13-02      gctgcaaagtgtggtgtctgaattgaactccggaagcggcttcaactggg
                     **************************************************

Q9E1F2_vNR13-01      gtcgatgcctggcgaccatagtcctcggcggctcgctggcaacggcgctg
Q9E1F2_vNR13-02      gtcgatgcctggcgaccatagtcctcggcggctcgctggcaacggcgctg
                     **************************************************

Q9E1F2_vNR13-01      tacgaaaacggctgtgaggaagggccaagccgcttggccgcagcgctggc
Q9E1F2_vNR13-02      tacgaaaacggctgtgaggaagggccaagccgcttggccgcagcgctggc
                     **************************************************

Q9E1F2_vNR13-01      cgcgtacctggccgaagagcagggcgagtggttgcgggagcacggcggat
Q9E1F2_vNR13-02      cgcgtacctggccgaagagcagggcgagtggttgcgggagcacggcggat
                     **************************************************

Q9E1F2_vNR13-01      ggg-----acggattctgtcgcttcttcgcccgttttggtcctgggctgg
Q9E1F2_vNR13-02      gggtaagcacgg----------------------------cacgggcggg
                     ***     ****                            *  **** **

Q9E1F2_vNR13-01      gagaggcgagtcaaaccttccctcttggtctcatcgtcgctg-cagccgg
Q9E1F2_vNR13-02      catgagcgg----------ctcgtttgg----gtcgccggtgtctgccag
                      *   ***           * *  ****     *** ** ** * *** *

Q9E1F2_vNR13-01      aatcg-ggataacggttctcatcgtcgtgtggcaattccaatcctaa
Q9E1F2_vNR13-02      aagcgaggagcaccgtgcgcggcgctg-gtag---------------
                     ** ** ***  ** ** * *  **  * ** *               

© 1998-2018