Dataset for CDS herpesviridae of organism Epstein Barr virus

[Download (right click)] [Edit] [Sequences] [Repertoires]

79 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A385JB67_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A075FCZ0_BALF1-0      --------------------------------------------------
A0A075FFB0_BALF1-0      --------------------------------------------------
A0A385J7X7_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TV67_BALF1-0      --------------------------------------------------
A0A2S1N1Z2_BALF1-0      atgaaccgggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1N2H2_BALF1-0      atgaaccgggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MZQ8_BALF1-0      atgaacctggccattactctggactctcctcacccaggcctcgcgtctta
U5YUM6_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A385JAB4_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0U3UKR9_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2D1LYV4_BALF1-0      --------------------------------------------------
Q91HV2_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TPI3_BALF1-0      --------------------------------------------------
A0A2S1MQV1_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7T8J1_BALF1-0      --------------------------------------------------
A0A2S1MP06_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MXY9_BALF1-0      atgaacctggccattgctctggactttcctcacccaggcctcgcgtctta
A0A0S2YQW9_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TJ32_BALF1-0      --------------------------------------------------
A0A385J8K7_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MV59_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MU91_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MM94_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0U3U737_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TLW1_BALF1-0      --------------------------------------------------
K9UT94_BALF1-01         --------------------------------------------------
P0CK58_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
P0CK59_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TUX3_BALF1-0      --------------------------------------------------
A0A2S1MTH2_BALF1-0      atgaacctggccattgctctggactctcatcacccaggcctcgcgtctta
A0A0S2YQS0_BHRF1-0      atg-----------------------------------------------
A0A2H4Z4F2_BHRF1-0      atg-----------------------------------------------
A0A0C7TQI4_BHRF1-0      atg-----------------------------------------------
A0A2S1N164_BHRF1-0      atg-----------------------------------------------
A0A0B6VHG4_BHRF1-0      atg-----------------------------------------------
A0A2H4Z4D6_BHRF1-0      atg-----------------------------------------------
A0A2H4Z4I0_BHRF1-0      atg-----------------------------------------------
A0A2H4Z4M5_BHRF1-0      atg-----------------------------------------------
A0A2H4Z4H8_BHRF1-0      atg-----------------------------------------------
A0A2H4Z4I4_BHRF1-0      atg-----------------------------------------------
A0A2S1MYK7_BHRF1-0      atg-----------------------------------------------
A0A2S1MX38_BHRF1-0      atg-----------------------------------------------
A0A2S1MWX4_BHRF1-0      atg-----------------------------------------------
A0A2S1MW70_BHRF1-0      atg-----------------------------------------------
A0A2H4Z4C5_BHRF1-0      atg-----------------------------------------------
G3CKQ0_BHRF1-01         atg-----------------------------------------------
A0A0C7U1E2_BHRF1-0      atg-----------------------------------------------
A0A2S1N3G0_BHRF1-0      atg-----------------------------------------------
V5KUE2_BHRF1-02         atg-----------------------------------------------
A0A385J9R2_BHRF1-0      atg-----------------------------------------------
A0A0C7T306_BHRF1-0      atg-----------------------------------------------
A0A385J7D0_BHRF1-0      atg-----------------------------------------------
A0A385J8Q6_BHRF1-0      atg-----------------------------------------------
A0A0C7T6R4_BHRF1-0      atg-----------------------------------------------
A0A0C7T924_BHRF1-0      atg-----------------------------------------------
A0A0X9C4Q9_BHRF1-0      atg-----------------------------------------------
A0A0X8YIW3_BHRF1-0      atg-----------------------------------------------
A0A385J922_BHRF1-0      atg-----------------------------------------------
A0A2H4Z4F8_BHRF1-0      atg-----------------------------------------------
A0A2H4Z4E3_BHRF1-0      atg-----------------------------------------------
A0A2H4Z4D9_BHRF1-0      atg-----------------------------------------------
K9UTF7_BHRF1-01         atg-----------------------------------------------
A0A0C7TWM2_BHRF1-0      atg-----------------------------------------------
A0A2D1LYW3_BHRF1-0      atg-----------------------------------------------
A0A0C7TK05_BHRF1-0      atg-----------------------------------------------
P03182_BHRF1-01         atg-----------------------------------------------
A0A385JAL1_BHRF1-0      atg-----------------------------------------------
A0A2S1N3U3_BHRF1-0      atg-----------------------------------------------
A0A2S1MNB9_BHRF1-0      atg-----------------------------------------------
A0A2S1MMY2_BHRF1-0      atg-----------------------------------------------
A0A0S2YRE8_BHRF1-0      atg-----------------------------------------------
A0A0C7TX82_BHRF1-0      atg-----------------------------------------------
A0A0C7TTN2_BHRF1-0      atg-----------------------------------------------
A0A0C7TNT4_BHRF1-0      atg-----------------------------------------------
A0A0C7SXB3_BHRF1-0      atg-----------------------------------------------
K9UTN7_BHRF1-01         atg-----------------------------------------------
P0C6Z1_BHRF1-01         atg-----------------------------------------------
V5KU29_BHRF1-02         atg-----------------------------------------------
                                                                          

A0A385JB67_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A075FCZ0_BALF1-0      --------------------------------------------------
A0A075FFB0_BALF1-0      --------------------------------------------------
A0A385J7X7_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TV67_BALF1-0      --------------------------------------------------
A0A2S1N1Z2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1N2H2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MZQ8_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
U5YUM6_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A385JAB4_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0U3UKR9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgaact
A0A2D1LYV4_BALF1-0      --------------------------------------------------
Q91HV2_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TPI3_BALF1-0      --------------------------------------------------
A0A2S1MQV1_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7T8J1_BALF1-0      --------------------------------------------------
A0A2S1MP06_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MXY9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0S2YQW9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TJ32_BALF1-0      --------------------------------------------------
A0A385J8K7_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MV59_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MU91_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MM94_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0U3U737_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TLW1_BALF1-0      --------------------------------------------------
K9UT94_BALF1-01         --------------------------------------------------
P0CK58_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
P0CK59_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TUX3_BALF1-0      --------------------------------------------------
A0A2S1MTH2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0S2YQS0_BHRF1-0      --------------gcccattcaacaagggag------------------
A0A2H4Z4F2_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A0C7TQI4_BHRF1-0      --------------gcctattcaacaagggat------------------
A0A2S1N164_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A0B6VHG4_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2H4Z4D6_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2H4Z4I0_BHRF1-0      --------------gcctattcaacaagggat------------------
A0A2H4Z4M5_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2H4Z4H8_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2H4Z4I4_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2S1MYK7_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2S1MX38_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2S1MWX4_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2S1MW70_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2H4Z4C5_BHRF1-0      --------------gcctattcaacaagggag------------------
G3CKQ0_BHRF1-01         --------------gcctattcaacaagggag------------------
A0A0C7U1E2_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2S1N3G0_BHRF1-0      --------------gcctattcaacaagggag------------------
V5KUE2_BHRF1-02         --------------gcctattcaacaagggag------------------
A0A385J9R2_BHRF1-0      --------------gcttattcaacaagggag------------------
A0A0C7T306_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A385J7D0_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A385J8Q6_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A0C7T6R4_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A0C7T924_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A0X9C4Q9_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A0X8YIW3_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A385J922_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2H4Z4F8_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2H4Z4E3_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2H4Z4D9_BHRF1-0      --------------gcctattcaacaagggag------------------
K9UTF7_BHRF1-01         --------------gcctattcaacaagggag------------------
A0A0C7TWM2_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2D1LYW3_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A0C7TK05_BHRF1-0      --------------gcctattcaacaagggag------------------
P03182_BHRF1-01         --------------gcctattcaacaagggag------------------
A0A385JAL1_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2S1N3U3_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2S1MNB9_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A2S1MMY2_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A0S2YRE8_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A0C7TX82_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A0C7TTN2_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A0C7TNT4_BHRF1-0      --------------gcctattcaacaagggag------------------
A0A0C7SXB3_BHRF1-0      --------------gcctattcaacaagggag------------------
K9UTN7_BHRF1-01         --------------gcctattcaacaagggag------------------
P0C6Z1_BHRF1-01         --------------gcctattcaacaagggag------------------
V5KU29_BHRF1-02         --------------gcctattcaacaagggag------------------
                                                                          

A0A385JB67_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A075FCZ0_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A075FFB0_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A385J7X7_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TV67_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A2S1N1Z2_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1N2H2_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MZQ8_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
U5YUM6_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A385JAB4_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagatgctgtgtttgtg
A0A0U3UKR9_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2D1LYV4_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
Q91HV2_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TPI3_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MQV1_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7T8J1_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MP06_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MXY9_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0S2YQW9_BALF1-0      ggcctgacgagaccatgaggcaagccaagtctacagattctgtgtttgtg
A0A0C7TJ32_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A385J8K7_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MV59_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MU91_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MM94_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0U3U737_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TLW1_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
K9UT94_BALF1-01         --------------atgaggccagccaagtctacagattctgtgtttgtg
P0CK58_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
P0CK59_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TUX3_BALF1-0      --------------atgaggcaagccaagtctacagattctgtgtttgtg
A0A2S1MTH2_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0S2YQS0_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2H4Z4F2_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A0C7TQI4_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2S1N164_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A0B6VHG4_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2H4Z4D6_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2H4Z4I0_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2H4Z4M5_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2H4Z4H8_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2H4Z4I4_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2S1MYK7_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2S1MX38_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2S1MWX4_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2S1MW70_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2H4Z4C5_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
G3CKQ0_BHRF1-01         --------------atactgttagcc-------------ctgtgtatacg
A0A0C7U1E2_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2S1N3G0_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
V5KUE2_BHRF1-02         --------------atactgttagcc-------------ctgtgtatacg
A0A385J9R2_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A0C7T306_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A385J7D0_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A385J8Q6_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A0C7T6R4_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A0C7T924_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A0X9C4Q9_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A0X8YIW3_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A385J922_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2H4Z4F8_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2H4Z4E3_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2H4Z4D9_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
K9UTF7_BHRF1-01         --------------atactgttagcc-------------ctgtgtatacg
A0A0C7TWM2_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2D1LYW3_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A0C7TK05_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
P03182_BHRF1-01         --------------atactgttagcc-------------ctgtgtatacg
A0A385JAL1_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2S1N3U3_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2S1MNB9_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A2S1MMY2_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A0S2YRE8_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A0C7TX82_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A0C7TTN2_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A0C7TNT4_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
A0A0C7SXB3_BHRF1-0      --------------atactgttagcc-------------ctgtgtatacg
K9UTN7_BHRF1-01         --------------atactgttagcc-------------ctgtgtatacg
P0C6Z1_BHRF1-01         --------------atactgttagcc-------------ctgtgtatacg
V5KU29_BHRF1-02         --------------atactgttagcc-------------ctgtgtatacg
                                      **   *  ****             ****** *  *

A0A385JB67_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A075FCZ0_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A075FFB0_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A385J7X7_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A0C7TV67_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A2S1N1Z2_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A2S1N2H2_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A2S1MZQ8_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
U5YUM6_BALF1-01         aagaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A385JAB4_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A0U3UKR9_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A2D1LYV4_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
Q91HV2_BALF1-01         aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A0C7TPI3_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A2S1MQV1_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A0C7T8J1_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A2S1MP06_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A2S1MXY9_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A0S2YQW9_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccatcgccgccggacgacaagg
A0A0C7TJ32_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A385J8K7_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A2S1MV59_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgcccttgccgccggacgacaagg
A0A2S1MU91_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A2S1MM94_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A0U3U737_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A0C7TLW1_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
K9UT94_BALF1-01         aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
P0CK58_BALF1-01         aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
P0CK59_BALF1-01         aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A0C7TUX3_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A2S1MTH2_BALF1-0      aggaccccggtcgag-gcgtgggtcgcgccctcgccgccggacgacaagg
A0A0S2YQS0_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2H4Z4F2_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0C7TQI4_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2S1N164_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0B6VHG4_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2H4Z4D6_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2H4Z4I0_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2H4Z4M5_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2H4Z4H8_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgc
A0A2H4Z4I4_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2S1MYK7_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2S1MX38_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2S1MWX4_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2S1MW70_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2H4Z4C5_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
G3CKQ0_BHRF1-01         gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0C7U1E2_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2S1N3G0_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
V5KUE2_BHRF1-02         gga----cagtcgtgtgcatg----------------------gaaatgg
A0A385J9R2_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0C7T306_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A385J7D0_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A385J8Q6_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0C7T6R4_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0C7T924_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0X9C4Q9_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0X8YIW3_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A385J922_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2H4Z4F8_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2H4Z4E3_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2H4Z4D9_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
K9UTF7_BHRF1-01         gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0C7TWM2_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2D1LYW3_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0C7TK05_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
P03182_BHRF1-01         gga----cagtcgtgtgcatg----------------------gaaatgg
A0A385JAL1_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2S1N3U3_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2S1MNB9_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A2S1MMY2_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0S2YRE8_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0C7TX82_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0C7TTN2_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0C7TNT4_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
A0A0C7SXB3_BHRF1-0      gga----cagtcgtgtgcatg----------------------gaaatgg
K9UTN7_BHRF1-01         gga----cagtcgtgtgcatg----------------------gaaatgg
P0C6Z1_BHRF1-01         gga----cagtcgtgtgcatg----------------------gaaatgg
V5KU29_BHRF1-02         gga----cagtcgtgtgcatg----------------------gaaatgg
                               * **** * ** **                      ** * * 

A0A385JB67_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A075FCZ0_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A075FFB0_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A385J7X7_BALF1-0      tggctgagtccagctacctcatgt-tcagagccatgtacgcggtgttcgc
A0A0C7TV67_BALF1-0      tggctgagtccagctacctcatgt-tcagagccatgtacgcggtgttcgc
A0A2S1N1Z2_BALF1-0      tggctgagtccagctacctcatgt-tcagagccatgtacgcggtgttcgc
A0A2S1N2H2_BALF1-0      tggctgagtccagctacctcatgt-tcagagccatgtacgcggtgttcgc
A0A2S1MZQ8_BALF1-0      tggctgagtccagctacctcatgt-tcagagccatgtacgcggtgttcgc
U5YUM6_BALF1-01         tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A385JAB4_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtatgcggtgttcac
A0A0U3UKR9_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A2D1LYV4_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
Q91HV2_BALF1-01         tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A0C7TPI3_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A2S1MQV1_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A0C7T8J1_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A2S1MP06_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A2S1MXY9_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A0S2YQW9_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A0C7TJ32_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A385J8K7_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A2S1MV59_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A2S1MU91_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A2S1MM94_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A0U3U737_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A0C7TLW1_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
K9UT94_BALF1-01         tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
P0CK58_BALF1-01         tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
P0CK59_BALF1-01         tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A0C7TUX3_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A2S1MTH2_BALF1-0      tggctgagtccagctacctcatgt-tcagggccatgtacgcggtgttcac
A0A0S2YQS0_BHRF1-0      tgtc---------ctgcatcctgtgttggagctag---------------
A0A2H4Z4F2_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A0C7TQI4_BHRF1-0      tgcc---------ctgcatcctgtgttggagctag---------------
A0A2S1N164_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A0B6VHG4_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A2H4Z4D6_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A2H4Z4I0_BHRF1-0      tgcc---------ctgcatcctgtgttggagctag---------------
A0A2H4Z4M5_BHRF1-0      ttcc---------ctgcatcctgtgttggagctag---------------
A0A2H4Z4H8_BHRF1-0      ttcc---------ctgcatcctgtgttggagctag---------------
A0A2H4Z4I4_BHRF1-0      ttcc---------ctgcatcctgtgttggagctag---------------
A0A2S1MYK7_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A2S1MX38_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A2S1MWX4_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A2S1MW70_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A2H4Z4C5_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
G3CKQ0_BHRF1-01         tacc---------ctgcatcctgtgttggagctag---------------
A0A0C7U1E2_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A2S1N3G0_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
V5KUE2_BHRF1-02         tacc---------ctgcatcctgtgttggagctag---------------
A0A385J9R2_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A0C7T306_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A385J7D0_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A385J8Q6_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A0C7T6R4_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A0C7T924_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A0X9C4Q9_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A0X8YIW3_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A385J922_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A2H4Z4F8_BHRF1-0      tatc---------ctgcatcctgtgttggagctag---------------
A0A2H4Z4E3_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A2H4Z4D9_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
K9UTF7_BHRF1-01         tacc---------ctgcatcctgtgttggagctag---------------
A0A0C7TWM2_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A2D1LYW3_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A0C7TK05_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
P03182_BHRF1-01         tacc---------ctgcatcctgtgttggagctag---------------
A0A385JAL1_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A2S1N3U3_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A2S1MNB9_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A2S1MMY2_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A0S2YRE8_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A0C7TX82_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A0C7TTN2_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A0C7TNT4_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
A0A0C7SXB3_BHRF1-0      tacc---------ctgcatcctgtgttggagctag---------------
K9UTN7_BHRF1-01         tacc---------ctgcatcctgtgttggagctag---------------
P0C6Z1_BHRF1-01         tacc---------ctgcatcctgtgttggagctag---------------
V5KU29_BHRF1-02         tacc---------ctgcatcctgtgttggagctag---------------
                        *  *         ** * ** *** *  * ** *                

A0A385JB67_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A075FCZ0_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A075FFB0_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A385J7X7_BALF1-0      cagggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A0C7TV67_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A2S1N1Z2_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A2S1N2H2_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A2S1MZQ8_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
U5YUM6_BALF1-01         ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A385JAB4_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A0U3UKR9_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A2D1LYV4_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
Q91HV2_BALF1-01         ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A0C7TPI3_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A2S1MQV1_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A0C7T8J1_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A2S1MP06_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A2S1MXY9_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A0S2YQW9_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A0C7TJ32_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A385J8K7_BALF1-0      ccgggatgagaaaaacct----gccttt-gccag----ccctggtcctct
A0A2S1MV59_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A2S1MU91_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A2S1MM94_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A0U3U737_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A0C7TLW1_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
K9UT94_BALF1-01         ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
P0CK58_BALF1-01         ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
P0CK59_BALF1-01         ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A0C7TUX3_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A2S1MTH2_BALF1-0      ccgggatgagaaagacct----gccttt-gccag----ccctggtcctct
A0A0S2YQS0_BHRF1-0      -cagcaagagaaacacctccccgcgtttcgccagaggacactgtagtgct
A0A2H4Z4F2_BHRF1-0      -cagcaagagaaacacctctccgcctttcaccagaggacactgtagttct
A0A0C7TQI4_BHRF1-0      -cagcaagagaaacacctccccgcctttcgccagaggacactgtagttct
A0A2S1N164_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A0B6VHG4_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A2H4Z4D6_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A2H4Z4I0_BHRF1-0      -cagcaagagaaacacctccccgcctttcgccagaggacactgtagttct
A0A2H4Z4M5_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A2H4Z4H8_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A2H4Z4I4_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A2S1MYK7_BHRF1-0      -cagcaagagaaacacctctctgcctttcaccagaggacactgtagttct
A0A2S1MX38_BHRF1-0      -cagcaagagaaacacctctccgcctttcaccagaggacactgtagttct
A0A2S1MWX4_BHRF1-0      -cagcaagagaaacacctctccgcctttcaccagaggacactgtagttct
A0A2S1MW70_BHRF1-0      -cagcaagagaaacacctctccgcctttcaccagaggacactgtagttct
A0A2H4Z4C5_BHRF1-0      -cagcaagagaaacacctctccgcctttcaccagaggacactgtagttct
G3CKQ0_BHRF1-01         -cagcaagagaaacacctctccgcctttcaccagaggacactgtagttct
A0A0C7U1E2_BHRF1-0      -catcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A2S1N3G0_BHRF1-0      -catcaagagaaacacctctccgcctttcgccagaggacactgtagttct
V5KUE2_BHRF1-02         -catcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A385J9R2_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A0C7T306_BHRF1-0      -cagcaagagaaacacatctccgcctttcgccagaggacactgtagttct
A0A385J7D0_BHRF1-0      -cagcaagagaaacacttctccgcctttcgccagaggacactgtagttct
A0A385J8Q6_BHRF1-0      -cagcaagagaaacacctctctgcctttcgccagaggacactgtagttct
A0A0C7T6R4_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A0C7T924_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A0X9C4Q9_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A0X8YIW3_BHRF1-0      -cagcgagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A385J922_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A2H4Z4F8_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A2H4Z4E3_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A2H4Z4D9_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
K9UTF7_BHRF1-01         -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A0C7TWM2_BHRF1-0      -cagcaagagaaacacctctccgccttttgccagaggacactgtagttct
A0A2D1LYW3_BHRF1-0      -cagcaagagaaacacctctccgccttttgccagaggacactgtagttct
A0A0C7TK05_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
P03182_BHRF1-01         -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A385JAL1_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A2S1N3U3_BHRF1-0      -caacaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A2S1MNB9_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A2S1MMY2_BHRF1-0      -cagcaagagaatcacctctccgcctttcgccagaggacactgtagttct
A0A0S2YRE8_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A0C7TX82_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A0C7TTN2_BHRF1-0      -cagcaagagaaacacctctccacctttcgccagaggacactgtagttct
A0A0C7TNT4_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
A0A0C7SXB3_BHRF1-0      -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
K9UTN7_BHRF1-01         -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
P0C6Z1_BHRF1-01         -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
V5KU29_BHRF1-02         -cagcaagagaaacacctctccgcctttcgccagaggacactgtagttct
                               *****  ** *     * ***  ****    * ***     **

A0A385JB67_BALF1-0      gccggcncancaaggccnccctgaggaaggataggaagctgtacgcggag
A0A075FCZ0_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagag
A0A075FFB0_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaggctgtacgcagag
A0A385J7X7_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A0C7TV67_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A2S1N1Z2_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacacggag
A0A2S1N2H2_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A2S1MZQ8_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
U5YUM6_BALF1-01         gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcagag
A0A385JAB4_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A0U3UKR9_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A2D1LYV4_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
Q91HV2_BALF1-01         gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A0C7TPI3_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A2S1MQV1_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A0C7T8J1_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A2S1MP06_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A2S1MXY9_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A0S2YQW9_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A0C7TJ32_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A385J8K7_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A2S1MV59_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A2S1MU91_BALF1-0      gccggctcatcaaggcctccctgaggaaggatagggagctgtacgcggag
A0A2S1MM94_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A0U3U737_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A0C7TLW1_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggac
K9UT94_BALF1-01         gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
P0CK58_BALF1-01         gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
P0CK59_BALF1-01         gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A0C7TUX3_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A2S1MTH2_BALF1-0      gccggctcatcaaggcctccctgaggaaggataggaagctgtacgcggag
A0A0S2YQS0_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2H4Z4F2_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0C7TQI4_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2S1N164_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0B6VHG4_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2H4Z4D6_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2H4Z4I0_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2H4Z4M5_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2H4Z4H8_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2H4Z4I4_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2S1MYK7_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2S1MX38_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2S1MWX4_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2S1MW70_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2H4Z4C5_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
G3CKQ0_BHRF1-01         gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0C7U1E2_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2S1N3G0_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
V5KUE2_BHRF1-02         gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A385J9R2_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0C7T306_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A385J7D0_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A385J8Q6_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0C7T6R4_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0C7T924_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0X9C4Q9_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0X8YIW3_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A385J922_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2H4Z4F8_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2H4Z4E3_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2H4Z4D9_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
K9UTF7_BHRF1-01         gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0C7TWM2_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2D1LYW3_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0C7TK05_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
P03182_BHRF1-01         gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A385JAL1_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2S1N3U3_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2S1MNB9_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A2S1MMY2_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0S2YRE8_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0C7TX82_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0C7TTN2_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0C7TNT4_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
A0A0C7SXB3_BHRF1-0      gc---gttatcatgtgttgcttgagg------agataattgaacg-----
K9UTN7_BHRF1-01         gc---gttatcatgtgttgcttgagg------agataattgaacg-----
P0C6Z1_BHRF1-01         gc---gttatcatgtgttgcttgagg------agataattgaacg-----
V5KU29_BHRF1-02         gc---gttatcatgtgttgcttgagg------agataattgaacg-----
                        **      * ** *     * *****      **     ** **      

A0A385JB67_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A075FCZ0_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A075FFB0_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A385J7X7_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A0C7TV67_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A2S1N1Z2_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A2S1N2H2_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A2S1MZQ8_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
U5YUM6_BALF1-01         ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A385JAB4_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A0U3UKR9_BALF1-0      ctggcctgcaggacagccgacatcaggggcaaagacacgcacgtacggct
A0A2D1LYV4_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
Q91HV2_BALF1-01         ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A0C7TPI3_BALF1-0      ctggcctgcaggacagccgacgtcgggggcaaagacacgcacgtacggct
A0A2S1MQV1_BALF1-0      ctggcctgcaggacagccgacgtcgggggcaaagacacgcacgtacggct
A0A0C7T8J1_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggat
A0A2S1MP06_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggat
A0A2S1MXY9_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A0S2YQW9_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A0C7TJ32_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A385J8K7_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A2S1MV59_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A2S1MU91_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A2S1MM94_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A0U3U737_BALF1-0      ctggcctgcaggacagccgacatcggggacaaagacacgcacgtacggct
A0A0C7TLW1_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
K9UT94_BALF1-01         ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
P0CK58_BALF1-01         ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
P0CK59_BALF1-01         ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A0C7TUX3_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A2S1MTH2_BALF1-0      ctggcctgcaggacagccgacatcgggggcaaagacacgcacgtacggct
A0A0S2YQS0_BHRF1-0      ------------------aaattcagatacatttacagaaacttgggaca
A0A2H4Z4F2_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A0C7TQI4_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2S1N164_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A0B6VHG4_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2H4Z4D6_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2H4Z4I0_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2H4Z4M5_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2H4Z4H8_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2H4Z4I4_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2S1MYK7_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2S1MX38_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2S1MWX4_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2S1MW70_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2H4Z4C5_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
G3CKQ0_BHRF1-01         ------------------aaattcagagacatttacagaaacttggaaca
A0A0C7U1E2_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2S1N3G0_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
V5KUE2_BHRF1-02         ------------------aaattcagagacatttacagaaacttggaaca
A0A385J9R2_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A0C7T306_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A385J7D0_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A385J8Q6_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A0C7T6R4_BHRF1-0      ------------------aaattcagagacattttcagaaacttggaaca
A0A0C7T924_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A0X9C4Q9_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A0X8YIW3_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A385J922_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2H4Z4F8_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2H4Z4E3_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2H4Z4D9_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
K9UTF7_BHRF1-01         ------------------aaattcagagacatttacagaaacttggaaca
A0A0C7TWM2_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2D1LYW3_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A0C7TK05_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
P03182_BHRF1-01         ------------------aaattcagagacatttacagaaacttggaaca
A0A385JAL1_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2S1N3U3_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2S1MNB9_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A2S1MMY2_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A0S2YRE8_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A0C7TX82_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A0C7TTN2_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A0C7TNT4_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
A0A0C7SXB3_BHRF1-0      ------------------aaattcagagacatttacagaaacttggaaca
K9UTN7_BHRF1-01         ------------------aaattcagagacatttacagaaacttggaaca
P0C6Z1_BHRF1-01         ------------------aaattcagagacatttacagaaacttggaaca
V5KU29_BHRF1-02         ------------------aaattcagagacatttacagaaacttggaaca
                                           *  ** *   **    **   ** *      

A0A385JB67_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A075FCZ0_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A075FFB0_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A385J7X7_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A0C7TV67_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A2S1N1Z2_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A2S1N2H2_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A2S1MZQ8_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
U5YUM6_BALF1-01         catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A385JAB4_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A0U3UKR9_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A2D1LYV4_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
Q91HV2_BALF1-01         catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A0C7TPI3_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A2S1MQV1_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A0C7T8J1_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A2S1MP06_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A2S1MXY9_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A0S2YQW9_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A0C7TJ32_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A385J8K7_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A2S1MV59_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A2S1MU91_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A2S1MM94_BALF1-0      catcatcagcgtcctgcgcgcattgtacaacgaccactacgactactgg-
A0A0U3U737_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A0C7TLW1_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
K9UT94_BALF1-01         catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
P0CK58_BALF1-01         catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
P0CK59_BALF1-01         catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A0C7TUX3_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A2S1MTH2_BALF1-0      catcatcagcgtcctgcgcgcagtgtacaacgaccactacgactactgg-
A0A0S2YQS0_BHRF1-0      gatt--------------tataacacacaccgaacatttggac--ctgga
A0A2H4Z4F2_BHRF1-0      gatt--------------tataacacacaccgaacatttggac--ctgga
A0A0C7TQI4_BHRF1-0      gatt--------------tataacacacaccgaaaatttggac--ctgga
A0A2S1N164_BHRF1-0      gatt--------------tataacacacaccgaacatttggac--ctgga
A0A0B6VHG4_BHRF1-0      gatt--------------tataacacacaccgaaaatttggac--ctgga
A0A2H4Z4D6_BHRF1-0      gatt--------------tataacacacaccgcaaatttggac--ctgga
A0A2H4Z4I0_BHRF1-0      gatt--------------tataacacacaccgaacatttggac--ctgga
A0A2H4Z4M5_BHRF1-0      gatt--------------tataacacacaccgaacatttggac--ctgga
A0A2H4Z4H8_BHRF1-0      gatt--------------tataacacacaccgaacatttggac--ctgga
A0A2H4Z4I4_BHRF1-0      gatt--------------tataacacacaccgaacatttggac--ctgga
A0A2S1MYK7_BHRF1-0      gatt--------------tataacacacaccgaacatttggac--ctgga
A0A2S1MX38_BHRF1-0      gatt--------------tttaacacacaccgaacatttggac--ctgga
A0A2S1MWX4_BHRF1-0      gatt--------------tacaacacacaccgaacatttggac--ctgga
A0A2S1MW70_BHRF1-0      gatt--------------tataacacacaccggacatttggac--ctgga
A0A2H4Z4C5_BHRF1-0      gatt--------------tataacacacaccgatcatttggac--ctgga
G3CKQ0_BHRF1-01         gatt--------------tataacacacaccgaacatttggac--ctgga
A0A0C7U1E2_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A2S1N3G0_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
V5KUE2_BHRF1-02         gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A385J9R2_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A0C7T306_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A385J7D0_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A385J8Q6_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A0C7T6R4_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A0C7T924_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A0X9C4Q9_BHRF1-0      gatt--------------tataagacacaccgaacatttggac--ctgga
A0A0X8YIW3_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A385J922_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A2H4Z4F8_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A2H4Z4E3_BHRF1-0      gttt--------------tataacacacaccgaacatgtggac--ctgga
A0A2H4Z4D9_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
K9UTF7_BHRF1-01         gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A0C7TWM2_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A2D1LYW3_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A0C7TK05_BHRF1-0      gatt--------------tataacacacaccgaacatgtggat--ctgga
P03182_BHRF1-01         gatt--------------tataacacacaccgaacatgtggat--ctgga
A0A385JAL1_BHRF1-0      gatt--------------tataacatacaccgaacatgtggac--ctgga
A0A2S1N3U3_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A2S1MNB9_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A2S1MMY2_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A0S2YRE8_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A0C7TX82_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A0C7TTN2_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A0C7TNT4_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
A0A0C7SXB3_BHRF1-0      gatt--------------tataacacacaccgaacatgtggac--ctgga
K9UTN7_BHRF1-01         gatt--------------tataacacacaccgaacatgtggac--ctgga
P0C6Z1_BHRF1-01         gatt--------------tataacacacaccgaacatgtggac--ctgga
V5KU29_BHRF1-02         gatt--------------tataacacacaccgaacatgtggac--ctgga
                          *                  *    *** **   *    **   **** 

A0A385JB67_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A075FCZ0_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A075FFB0_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A385J7X7_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A0C7TV67_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A2S1N1Z2_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A2S1N2H2_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A2S1MZQ8_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
U5YUM6_BALF1-01         tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A385JAB4_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A0U3UKR9_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A2D1LYV4_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
Q91HV2_BALF1-01         tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A0C7TPI3_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A2S1MQV1_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A0C7T8J1_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A2S1MP06_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A2S1MXY9_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A0S2YQW9_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A0C7TJ32_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A385J8K7_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A2S1MV59_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A2S1MU91_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A2S1MM94_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A0U3U737_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A0C7TLW1_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
K9UT94_BALF1-01         tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
P0CK58_BALF1-01         tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
P0CK59_BALF1-01         tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A0C7TUX3_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A2S1MTH2_BALF1-0      tcgcggctcagggtggt--gctgtgctacacagtggtg--------tttg
A0A0S2YQS0_BHRF1-0      ttttaactcaatatttttagagatatttcaccgtggagacccaagccgtg
A0A2H4Z4F2_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagaccccagccttg
A0A0C7TQI4_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2S1N164_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A0B6VHG4_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2H4Z4D6_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2H4Z4I0_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2H4Z4M5_BHRF1-0      ttttaactcagtattttttgagatatttcaccgtggagacccaagccttg
A0A2H4Z4H8_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2H4Z4I4_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2S1MYK7_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2S1MX38_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2S1MWX4_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2S1MW70_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2H4Z4C5_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
G3CKQ0_BHRF1-01         ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A0C7U1E2_BHRF1-0      ttttaattcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2S1N3G0_BHRF1-0      ttttaattcagtatttttagagatatttcaccgtggagacccaagccttg
V5KUE2_BHRF1-02         ttttaattcagtatttttagagatatttcaccgtggagacccaagccttg
A0A385J9R2_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagrcccaagccttg
A0A0C7T306_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A385J7D0_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A385J8Q6_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A0C7T6R4_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A0C7T924_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A0X9C4Q9_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A0X8YIW3_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A385J922_BHRF1-0      ttttaactcagtatttgtagagatatttcaccgtggagacccaagccttg
A0A2H4Z4F8_BHRF1-0      ttttaactcagtatttgtagagatatttcaccgtggagacccaagccttg
A0A2H4Z4E3_BHRF1-0      ttttaactcagtatttgtagagatatttcaccgtggagacccaagccttg
A0A2H4Z4D9_BHRF1-0      ttttaactcagtatttgtagagatatttcaccgtggagacccaagccttg
K9UTF7_BHRF1-01         ttttaactcagtatttgtagagatatttcaccgtggagacccaagccttg
A0A0C7TWM2_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2D1LYW3_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A0C7TK05_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
P03182_BHRF1-01         ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A385JAL1_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2S1N3U3_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2S1MNB9_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A2S1MMY2_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A0S2YRE8_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagacttg
A0A0C7TX82_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A0C7TTN2_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A0C7TNT4_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
A0A0C7SXB3_BHRF1-0      ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
K9UTN7_BHRF1-01         ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
P0C6Z1_BHRF1-01         ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
V5KU29_BHRF1-02         ttttaactcagtatttttagagatatttcaccgtggagacccaagccttg
                        *      ***   *     *   *  * *** **** *          **

A0A385JB67_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A075FCZ0_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A075FFB0_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A385J7X7_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A0C7TV67_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A2S1N1Z2_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A2S1N2H2_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A2S1MZQ8_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
U5YUM6_BALF1-01         cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A385JAB4_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A0U3UKR9_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A2D1LYV4_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
Q91HV2_BALF1-01         cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A0C7TPI3_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A2S1MQV1_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A0C7T8J1_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A2S1MP06_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A2S1MXY9_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A0S2YQW9_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A0C7TJ32_BALF1-0      cggtgcgaaactacctgaatgacc----acaagagcgcc-----gccttc
A0A385J8K7_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A2S1MV59_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A2S1MU91_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A2S1MM94_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A0U3U737_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A0C7TLW1_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
K9UT94_BALF1-01         cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
P0CK58_BALF1-01         cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
P0CK59_BALF1-01         cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A0C7TUX3_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A2S1MTH2_BALF1-0      cggtgcgaaactacctggatgacc----acaagagcgcc-----gccttc
A0A0S2YQS0_BHRF1-0      -ggcgcgcgttggcctggctggcctggtgcatgcatgcctgcaggacatt
A0A2H4Z4F2_BHRF1-0      -ggtgcgcgttgacctggatggcctggggcatgcatgcctgttggacctt
A0A0C7TQI4_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A2S1N164_BHRF1-0      -ggcgtgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A0B6VHG4_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A2H4Z4D6_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A2H4Z4I0_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgtaggacatt
A0A2H4Z4M5_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgtaggacatt
A0A2H4Z4H8_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgtaggacatt
A0A2H4Z4I4_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgtaggacatt
A0A2S1MYK7_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgtaggacatt
A0A2S1MX38_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgtaggacatt
A0A2S1MWX4_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgtaggacatt
A0A2S1MW70_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgtaggacatt
A0A2H4Z4C5_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgtaggacatt
G3CKQ0_BHRF1-01         -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgtaggacatt
A0A0C7U1E2_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A2S1N3G0_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
V5KUE2_BHRF1-02         -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A385J9R2_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A0C7T306_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A385J7D0_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A385J8Q6_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A0C7T6R4_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A0C7T924_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A0X9C4Q9_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A0X8YIW3_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcagggcatt
A0A385J922_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A2H4Z4F8_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A2H4Z4E3_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A2H4Z4D9_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
K9UTF7_BHRF1-01         -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A0C7TWM2_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A2D1LYW3_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggagatt
A0A0C7TK05_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
P03182_BHRF1-01         -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A385JAL1_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A2S1N3U3_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A2S1MNB9_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A2S1MMY2_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A0S2YRE8_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A0C7TX82_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgtatgcctgcaggacatt
A0A0C7TTN2_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A0C7TNT4_BHRF1-0      -ggcgcacgttggcctggatggcctggtgcatgcatgcctgcaggacatt
A0A0C7SXB3_BHRF1-0      -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
K9UTN7_BHRF1-01         -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
P0C6Z1_BHRF1-01         -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
V5KU29_BHRF1-02         -ggcgcgcgttggcctggatggcctggtgcatgcatgcctgcaggacatt
                         ** *        ****  ** **     ** *   ***     *   * 

A0A385JB67_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A075FCZ0_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A075FFB0_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A385J7X7_BALF1-0      gtgctgggggcaata-gcccactacc------tggccct-----------
A0A0C7TV67_BALF1-0      gtgctgggggcaata-gcccactacc------tggccct-----------
A0A2S1N1Z2_BALF1-0      gtgctgggggcaata-gcccactacc------tggccct-----------
A0A2S1N2H2_BALF1-0      gtgctgggggcaata-gcccactacc------tggccct-----------
A0A2S1MZQ8_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
U5YUM6_BALF1-01         gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A385JAB4_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A0U3UKR9_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A2D1LYV4_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
Q91HV2_BALF1-01         gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A0C7TPI3_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A2S1MQV1_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A0C7T8J1_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A2S1MP06_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A2S1MXY9_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A0S2YQW9_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A0C7TJ32_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A385J8K7_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A2S1MV59_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A2S1MU91_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A2S1MM94_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A0U3U737_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A0C7TLW1_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
K9UT94_BALF1-01         gtgctgggggcaatc-gcccactacc------tggccct-----------
P0CK58_BALF1-01         gtgctgggggcaatc-gcccactacc------tggccct-----------
P0CK59_BALF1-01         gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A0C7TUX3_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A2S1MTH2_BALF1-0      gtgctgggggcaatc-gcccactacc------tggccct-----------
A0A0S2YQS0_BHRF1-0      gtgttgtaaccaggacactccttactatgttgtggacctgtcagttcgtg
A0A2H4Z4F2_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0C7TQI4_BHRF1-0      gtgttgtaaccagtatactccttactatgttgtggacctgtcagttcgtg
A0A2S1N164_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0B6VHG4_BHRF1-0      gtgttgtaaccagtatactccttactatgttgtggacctgtcagttcgtg
A0A2H4Z4D6_BHRF1-0      gtgttgtaaccagtatactccttactatgttgtggacctgtcagttcgtg
A0A2H4Z4I0_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2H4Z4M5_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2H4Z4H8_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2H4Z4I4_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2S1MYK7_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2S1MX38_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2S1MWX4_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2S1MW70_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2H4Z4C5_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
G3CKQ0_BHRF1-01         gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0C7U1E2_BHRF1-0      gtgttataaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2S1N3G0_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
V5KUE2_BHRF1-02         gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A385J9R2_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0C7T306_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A385J7D0_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A385J8Q6_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0C7T6R4_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0C7T924_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0X9C4Q9_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0X8YIW3_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A385J922_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2H4Z4F8_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2H4Z4E3_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2H4Z4D9_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
K9UTF7_BHRF1-01         gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0C7TWM2_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2D1LYW3_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0C7TK05_BHRF1-0      gtgttgtaacccgtctactccttactatgttgtggacctgtcagttcgtg
P03182_BHRF1-01         gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A385JAL1_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2S1N3U3_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2S1MNB9_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A2S1MMY2_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0S2YRE8_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0C7TX82_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0C7TTN2_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0C7TNT4_BHRF1-0      gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
A0A0C7SXB3_BHRF1-0      gtgttttaaccagtctactccttactatgttgtggacctgtcagttcgtg
K9UTN7_BHRF1-01         gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
P0C6Z1_BHRF1-01         gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
V5KU29_BHRF1-02         gtgttgtaaccagtctactccttactatgttgtggacctgtcagttcgtg
                        *** *     *      * *  ***       *** ***           

A0A385JB67_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A075FCZ0_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A075FFB0_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A385J7X7_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A0C7TV67_BALF1-0      ------------ctatcgcagaatctggtttgcgaggct--------ggg
A0A2S1N1Z2_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A2S1N2H2_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A2S1MZQ8_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
U5YUM6_BALF1-01         ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A385JAB4_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A0U3UKR9_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A2D1LYV4_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
Q91HV2_BALF1-01         ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A0C7TPI3_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A2S1MQV1_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A0C7T8J1_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A2S1MP06_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A2S1MXY9_BALF1-0      ------------ctatcgcagaccctggtttgcgaggct--------ggg
A0A0S2YQW9_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A0C7TJ32_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A385J8K7_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A2S1MV59_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A2S1MU91_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A2S1MM94_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A0U3U737_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A0C7TLW1_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
K9UT94_BALF1-01         ------------ctatcgcagactctggtttgcgaggct--------ggg
P0CK58_BALF1-01         ------------ctatcgcagactctggtttgcgaggct--------ggg
P0CK59_BALF1-01         ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A0C7TUX3_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A2S1MTH2_BALF1-0      ------------ctatcgcagactctggtttgcgaggct--------ggg
A0A0S2YQS0_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2H4Z4F2_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0C7TQI4_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2S1N164_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0B6VHG4_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2H4Z4D6_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2H4Z4I0_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2H4Z4M5_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2H4Z4H8_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2H4Z4I4_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2S1MYK7_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2S1MX38_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2S1MWX4_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2S1MW70_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2H4Z4C5_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
G3CKQ0_BHRF1-01         ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0C7U1E2_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2S1N3G0_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
V5KUE2_BHRF1-02         ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A385J9R2_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0C7T306_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A385J7D0_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A385J8Q6_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0C7T6R4_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0C7T924_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0X9C4Q9_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0X8YIW3_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A385J922_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2H4Z4F8_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2H4Z4E3_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2H4Z4D9_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
K9UTF7_BHRF1-01         ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0C7TWM2_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2D1LYW3_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0C7TK05_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
P03182_BHRF1-01         ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A385JAL1_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2S1N3U3_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2S1MNB9_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A2S1MMY2_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0S2YRE8_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0C7TX82_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0C7TTN2_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0C7TNT4_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
A0A0C7SXB3_BHRF1-0      ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
K9UTN7_BHRF1-01         ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
P0C6Z1_BHRF1-01         ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
V5KU29_BHRF1-02         ggatgttagaagccagcgaaggc-ctggatggttggattcatcaacaggg
                                    * * ** **   **** * *   *  *        ***

A0A385JB67_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gtttc
A0A075FCZ0_BALF1-0      cggcatgccaagatcgct--gaaacgtca----------------gttcc
A0A075FFB0_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A385J7X7_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A0C7TV67_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A2S1N1Z2_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A2S1N2H2_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A2S1MZQ8_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
U5YUM6_BALF1-01         cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A385JAB4_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A0U3UKR9_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A2D1LYV4_BALF1-0      cggcatgccaagatcgct--gagatgtca----------------gttcc
Q91HV2_BALF1-01         cggcatgccaagatcgct--gagatgtca----------------gttcc
A0A0C7TPI3_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A2S1MQV1_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A0C7T8J1_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A2S1MP06_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A2S1MXY9_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A0S2YQW9_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A0C7TJ32_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A385J8K7_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A2S1MV59_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A2S1MU91_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A2S1MM94_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A0U3U737_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A0C7TLW1_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
K9UT94_BALF1-01         cggcatgccaagatcgct--gagacgtca----------------gttcc
P0CK58_BALF1-01         cggcatgccaagatcgct--gagacgtca----------------gttcc
P0CK59_BALF1-01         cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A0C7TUX3_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A2S1MTH2_BALF1-0      cggcatgccaagatcgct--gagacgtca----------------gttcc
A0A0S2YQS0_BHRF1-0      tggctggtctacattaattgaagacaacattcctggctccagaagcttta
A0A2H4Z4F2_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A0C7TQI4_BHRF1-0      cggctggtctacattaattgaaaacaacattcctggctccagaaggttta
A0A2S1N164_BHRF1-0      cggctggtctacattaattgaagacaactttcctggatccagaaggttta
A0A0B6VHG4_BHRF1-0      cggctggtctacattaattgaagacaacattcctggctccagaaggttta
A0A2H4Z4D6_BHRF1-0      cggctggtctacattaattgaagacaacattcctggctccagaaggttta
A0A2H4Z4I0_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2H4Z4M5_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2H4Z4H8_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2H4Z4I4_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2S1MYK7_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2S1MX38_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2S1MWX4_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2S1MW70_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2H4Z4C5_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
G3CKQ0_BHRF1-01         cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A0C7U1E2_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2S1N3G0_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
V5KUE2_BHRF1-02         cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A385J9R2_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A0C7T306_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A385J7D0_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A385J8Q6_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A0C7T6R4_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A0C7T924_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaagttta
A0A0X9C4Q9_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A0X8YIW3_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A385J922_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaagtttta
A0A2H4Z4F8_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2H4Z4E3_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2H4Z4D9_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
K9UTF7_BHRF1-01         cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A0C7TWM2_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2D1LYW3_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A0C7TK05_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
P03182_BHRF1-01         cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A385JAL1_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2S1N3U3_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A2S1MNB9_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatacagaaggttta
A0A2S1MMY2_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A0S2YRE8_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A0C7TX82_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A0C7TTN2_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A0C7TNT4_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
A0A0C7SXB3_BHRF1-0      cggctggtctacattaattgaagacaacattcctggatccagaaggttta
K9UTN7_BHRF1-01         cggctggtctacattaattgaagacaacattcctggatccagaaggttta
P0C6Z1_BHRF1-01         cggctggtctacattaattgaagacaacattcctggatccagaaggttta
V5KU29_BHRF1-02         cggctggtctacattaattgaagacaacattcctggatccagaaggttta
                         ***  * * * **   *   * *   *                  **  

A0A385JB67_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A075FCZ0_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A075FFB0_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A385J7X7_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A0C7TV67_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A2S1N1Z2_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A2S1N2H2_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A2S1MZQ8_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
U5YUM6_BALF1-01         ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A385JAB4_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A0U3UKR9_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A2D1LYV4_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
Q91HV2_BALF1-01         ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A0C7TPI3_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A2S1MQV1_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A0C7T8J1_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A2S1MP06_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A2S1MXY9_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A0S2YQW9_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A0C7TJ32_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A385J8K7_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A2S1MV59_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A2S1MU91_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A2S1MM94_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A0U3U737_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A0C7TLW1_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
K9UT94_BALF1-01         ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
P0CK58_BALF1-01         ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
P0CK59_BALF1-01         ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A0C7TUX3_BALF1-0      ccgtgacgtgggccctggccagcctgac--tgacttcctgaaatctttgt
A0A2S1MTH2_BALF1-0      ccgtgacgtgggccctggcaagcctgac--tgacttcctgaaatctttgt
A0A0S2YQS0_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttgtatgt
A0A2H4Z4F2_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A0C7TQI4_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2S1N164_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgc
A0A0B6VHG4_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2H4Z4D6_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2H4Z4I0_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2H4Z4M5_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2H4Z4H8_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2H4Z4I4_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2S1MYK7_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2S1MX38_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2S1MWX4_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2S1MW70_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2H4Z4C5_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
G3CKQ0_BHRF1-01         gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A0C7U1E2_BHRF1-0      gctggactttgtttctcgctggactgactttgagtctgttagttatatgt
A0A2S1N3G0_BHRF1-0      gctggactttgtttctcgctggactgactttgagtctgttagttatatgt
V5KUE2_BHRF1-02         gctggactttgtttctcgctggactgactttgagtctgttagttatatgt
A0A385J9R2_BHRF1-0      gctggactttgtttctcgctggactgactttgagtctgttagttatatgt
A0A0C7T306_BHRF1-0      gctggactttgtttctcgctggactgactttgagtctgttagttatatgt
A0A385J7D0_BHRF1-0      gctggactttgtttctcgctggactgactttgagtctgttagttatatgt
A0A385J8Q6_BHRF1-0      gctggactttgtttctcgctggactgactttgagtctgttagttatatgt
A0A0C7T6R4_BHRF1-0      gctggactttgtttctcgctggactgactttgagtctgttagttatatgt
A0A0C7T924_BHRF1-0      gctggactttgtttctcgctggactgactttgagtctgttagttatatgt
A0A0X9C4Q9_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A0X8YIW3_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A385J922_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2H4Z4F8_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2H4Z4E3_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2H4Z4D9_BHRF1-0      tctggactttgtttcttgctggactgactttgagtctgttagttatatgt
K9UTF7_BHRF1-01         gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A0C7TWM2_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2D1LYW3_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A0C7TK05_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
P03182_BHRF1-01         gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A385JAL1_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2S1N3U3_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2S1MNB9_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A2S1MMY2_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A0S2YRE8_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A0C7TX82_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A0C7TTN2_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A0C7TNT4_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
A0A0C7SXB3_BHRF1-0      gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
K9UTN7_BHRF1-01         gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
P0C6Z1_BHRF1-01         gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
V5KU29_BHRF1-02         gctggactttgtttcttgctggactgactttgagtctgttagttatatgt
                         *  *** * *   ** **  * *****  *** *   * *  * * ** 

A0A385JB67_BALF1-0      aa-------------------------------
A0A075FCZ0_BALF1-0      aa-------------------------------
A0A075FFB0_BALF1-0      aa-------------------------------
A0A385J7X7_BALF1-0      aa-------------------------------
A0A0C7TV67_BALF1-0      aa-------------------------------
A0A2S1N1Z2_BALF1-0      aa-------------------------------
A0A2S1N2H2_BALF1-0      aa-------------------------------
A0A2S1MZQ8_BALF1-0      aa-------------------------------
U5YUM6_BALF1-01         aa-------------------------------
A0A385JAB4_BALF1-0      aa-------------------------------
A0A0U3UKR9_BALF1-0      aa-------------------------------
A0A2D1LYV4_BALF1-0      aa-------------------------------
Q91HV2_BALF1-01         aa-------------------------------
A0A0C7TPI3_BALF1-0      aa-------------------------------
A0A2S1MQV1_BALF1-0      aa-------------------------------
A0A0C7T8J1_BALF1-0      aa-------------------------------
A0A2S1MP06_BALF1-0      aa-------------------------------
A0A2S1MXY9_BALF1-0      aa-------------------------------
A0A0S2YQW9_BALF1-0      aa-------------------------------
A0A0C7TJ32_BALF1-0      aa-------------------------------
A0A385J8K7_BALF1-0      aa-------------------------------
A0A2S1MV59_BALF1-0      aa-------------------------------
A0A2S1MU91_BALF1-0      aa-------------------------------
A0A2S1MM94_BALF1-0      aa-------------------------------
A0A0U3U737_BALF1-0      aa-------------------------------
A0A0C7TLW1_BALF1-0      aa-------------------------------
K9UT94_BALF1-01         aa-------------------------------
P0CK58_BALF1-01         aa-------------------------------
P0CK59_BALF1-01         aa-------------------------------
A0A0C7TUX3_BALF1-0      aa-------------------------------
A0A2S1MTH2_BALF1-0      aa-------------------------------
A0A0S2YQS0_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2H4Z4F2_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A0C7TQI4_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2S1N164_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A0B6VHG4_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2H4Z4D6_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2H4Z4I0_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2H4Z4M5_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2H4Z4H8_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2H4Z4I4_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2S1MYK7_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2S1MX38_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2S1MWX4_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2S1MW70_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2H4Z4C5_BHRF1-0      agttatttatttatctccagaggaagacactaa
G3CKQ0_BHRF1-01         agttatttatttatctccagaggaagacactaa
A0A0C7U1E2_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2S1N3G0_BHRF1-0      agttatttatttatctccagaggaagacagtaa
V5KUE2_BHRF1-02         agttatttatttatctccagaggaagacactaa
A0A385J9R2_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A0C7T306_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A385J7D0_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A385J8Q6_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A0C7T6R4_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A0C7T924_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A0X9C4Q9_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A0X8YIW3_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A385J922_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2H4Z4F8_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2H4Z4E3_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2H4Z4D9_BHRF1-0      agttatttatttatctccagaggaagacactaa
K9UTF7_BHRF1-01         agttatttatttatctccagaggaagacactaa
A0A0C7TWM2_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2D1LYW3_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A0C7TK05_BHRF1-0      agttatttatttatctccagaggaagacactaa
P03182_BHRF1-01         agttatttatttatctccagaggaagacactaa
A0A385JAL1_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2S1N3U3_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2S1MNB9_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A2S1MMY2_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A0S2YRE8_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A0C7TX82_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A0C7TTN2_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A0C7TNT4_BHRF1-0      agttatttatttatctccagaggaagacactaa
A0A0C7SXB3_BHRF1-0      agttatttatttatctccagaggaagacactaa
K9UTN7_BHRF1-01         agttatttatttatctccagaggaagacactaa
P0C6Z1_BHRF1-01         agttatttatttatctccagaggaagacactaa
V5KU29_BHRF1-02         agttatttatttatctccagaggaagacagtaa
                        *                                

© 1998-2019