Dataset for CDS BALF1 of organism Epstein Barr virus

[Download (right click)] [Edit] [Sequences] [Repertoires]

17 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A0C7TV67_BALF1-0      --------------------------------------------------
U5YUM6_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TUX3_BALF1-0      --------------------------------------------------
A0A0S2YQW9_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0U3UKR9_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TPI3_BALF1-0      --------------------------------------------------
A0A0C7T8J1_BALF1-0      --------------------------------------------------
A0A2D1LYV4_BALF1-0      --------------------------------------------------
Q91HV2_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TJ32_BALF1-0      --------------------------------------------------
A0A0U3U737_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TLW1_BALF1-0      --------------------------------------------------
K9UT94_BALF1-01         --------------------------------------------------
P0CK58_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
P0CK59_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A075FCZ0_BALF1-0      --------------------------------------------------
A0A075FFB0_BALF1-0      --------------------------------------------------
                                                                          

A0A0C7TV67_BALF1-0      --------------------------------------------------
U5YUM6_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TUX3_BALF1-0      --------------------------------------------------
A0A0S2YQW9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0U3UKR9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgaact
A0A0C7TPI3_BALF1-0      --------------------------------------------------
A0A0C7T8J1_BALF1-0      --------------------------------------------------
A0A2D1LYV4_BALF1-0      --------------------------------------------------
Q91HV2_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TJ32_BALF1-0      --------------------------------------------------
A0A0U3U737_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TLW1_BALF1-0      --------------------------------------------------
K9UT94_BALF1-01         --------------------------------------------------
P0CK58_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
P0CK59_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A075FCZ0_BALF1-0      --------------------------------------------------
A0A075FFB0_BALF1-0      --------------------------------------------------
                                                                          

A0A0C7TV67_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
U5YUM6_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TUX3_BALF1-0      --------------atgaggcaagccaagtctacagattctgtgtttgtg
A0A0S2YQW9_BALF1-0      ggcctgacgagaccatgaggcaagccaagtctacagattctgtgtttgtg
A0A0U3UKR9_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TPI3_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A0C7T8J1_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A2D1LYV4_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
Q91HV2_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TJ32_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A0U3U737_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TLW1_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
K9UT94_BALF1-01         --------------atgaggccagccaagtctacagattctgtgtttgtg
P0CK58_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
P0CK59_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A075FCZ0_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A075FFB0_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
                                      ******* ****************************

A0A0C7TV67_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
U5YUM6_BALF1-01         aagaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7TUX3_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0S2YQW9_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccatcgccgccggacgacaaggt
A0A0U3UKR9_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7TPI3_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7T8J1_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2D1LYV4_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
Q91HV2_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7TJ32_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0U3U737_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7TLW1_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
K9UT94_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
P0CK58_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
P0CK59_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A075FCZ0_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A075FFB0_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
                        * *************************** ********************

A0A0C7TV67_BALF1-0      ggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgccc
U5YUM6_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7TUX3_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0S2YQW9_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0U3UKR9_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7TPI3_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7T8J1_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2D1LYV4_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
Q91HV2_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7TJ32_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0U3U737_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7TLW1_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
K9UT94_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
P0CK58_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
P0CK59_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A075FCZ0_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A075FFB0_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
                        *************************** ****************** ***

A0A0C7TV67_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
U5YUM6_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TUX3_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0S2YQW9_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0U3UKR9_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TPI3_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7T8J1_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2D1LYV4_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
Q91HV2_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TJ32_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0U3U737_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TLW1_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
K9UT94_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
P0CK58_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
P0CK59_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A075FCZ0_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A075FFB0_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
                        **************************************************

A0A0C7TV67_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
U5YUM6_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A0C7TUX3_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0S2YQW9_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0U3UKR9_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7TPI3_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7T8J1_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2D1LYV4_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
Q91HV2_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7TJ32_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0U3U737_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7TLW1_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggacctggcctgcag
K9UT94_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
P0CK58_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
P0CK59_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A075FCZ0_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A075FFB0_BALF1-0      aaggcctccctgaggaaggataggaggctgtacgcagagctggcctgcag
                        ************************* ********* ** ***********

A0A0C7TV67_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
U5YUM6_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7TUX3_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0S2YQW9_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0U3UKR9_BALF1-0      gacagccgacatcaggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7TPI3_BALF1-0      gacagccgacgtcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7T8J1_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggatcatcatcagcg
A0A2D1LYV4_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
Q91HV2_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7TJ32_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0U3U737_BALF1-0      gacagccgacatcggggacaaagacacgcacgtacggctcatcatcagcg
A0A0C7TLW1_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
K9UT94_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
P0CK58_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
P0CK59_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A075FCZ0_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A075FFB0_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
                        ********** ** *** ******************* ************

A0A0C7TV67_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
U5YUM6_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TUX3_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0S2YQW9_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0U3UKR9_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TPI3_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7T8J1_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2D1LYV4_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
Q91HV2_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TJ32_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0U3U737_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TLW1_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
K9UT94_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
P0CK58_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
P0CK59_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A075FCZ0_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A075FFB0_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
                        **************************************************

A0A0C7TV67_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
U5YUM6_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TUX3_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0S2YQW9_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0U3UKR9_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TPI3_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7T8J1_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2D1LYV4_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
Q91HV2_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TJ32_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctgaatga
A0A0U3U737_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TLW1_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
K9UT94_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
P0CK58_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
P0CK59_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A075FCZ0_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A075FFB0_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
                        ********************************************* ****

A0A0C7TV67_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccc
U5YUM6_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7TUX3_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0S2YQW9_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0U3UKR9_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7TPI3_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7T8J1_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2D1LYV4_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
Q91HV2_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7TJ32_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0U3U737_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7TLW1_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
K9UT94_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
P0CK58_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
P0CK59_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A075FCZ0_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A075FFB0_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
                        ********************************* ****************

A0A0C7TV67_BALF1-0      tctatcgcagaatctggtttgcgaggctgggcggcatgccaagatcgctg
U5YUM6_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TUX3_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0S2YQW9_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0U3UKR9_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TPI3_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7T8J1_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2D1LYV4_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
Q91HV2_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TJ32_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0U3U737_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TLW1_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
K9UT94_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
P0CK58_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
P0CK59_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A075FCZ0_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A075FFB0_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
                        *********** **************************************

A0A0C7TV67_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
U5YUM6_BALF1-01         agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TUX3_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0S2YQW9_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0U3UKR9_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TPI3_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7T8J1_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2D1LYV4_BALF1-0      agatgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
Q91HV2_BALF1-01         agatgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TJ32_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0U3U737_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TLW1_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
K9UT94_BALF1-01         agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
P0CK58_BALF1-01         agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
P0CK59_BALF1-01         agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A075FCZ0_BALF1-0      aaacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A075FFB0_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
                        * * **********************************************

A0A0C7TV67_BALF1-0      gaaatctttgtaa
U5YUM6_BALF1-01         gaaatctttgtaa
A0A0C7TUX3_BALF1-0      gaaatctttgtaa
A0A0S2YQW9_BALF1-0      gaaatctttgtaa
A0A0U3UKR9_BALF1-0      gaaatctttgtaa
A0A0C7TPI3_BALF1-0      gaaatctttgtaa
A0A0C7T8J1_BALF1-0      gaaatctttgtaa
A0A2D1LYV4_BALF1-0      gaaatctttgtaa
Q91HV2_BALF1-01         gaaatctttgtaa
A0A0C7TJ32_BALF1-0      gaaatctttgtaa
A0A0U3U737_BALF1-0      gaaatctttgtaa
A0A0C7TLW1_BALF1-0      gaaatctttgtaa
K9UT94_BALF1-01         gaaatctttgtaa
P0CK58_BALF1-01         gaaatctttgtaa
P0CK59_BALF1-01         gaaatctttgtaa
A0A075FCZ0_BALF1-0      gaaatctttgtaa
A0A075FFB0_BALF1-0      gaaatctttgtaa
                        *************

© 1998-2018