Dataset for CDS herpesviridae of organism Cercopithecine herpesvirus 12

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q99F66_BALF1-01      atgaaggccgccaagtctaca---gattcggtgtt-------------tg
Q9Q5K8_BHRF1-01      atg------gcctattctacaagggatttactgttagctttgtgtatgcg
Q9WGB5_BHRF1-01      atg------gcctattctacaagggatttactgttagctttgtgtatgcg
                     ***      *** * ******   ****   ****              *

Q99F66_BALF1-01      tgaggaccccggtc---gaggcgtgggtctcgccttccccgc-----ccg
Q9Q5K8_BHRF1-01      ggatggtcacgtttatggaggcgacggt-ttgcatcctgtgttggagttg
Q9WGB5_BHRF1-01      ggatggtcacgtttatggaggcgacggt-ttgcatcctgtgttggagttg
                      ** *  * ** *    ******  *** * ** * *   *        *

Q99F66_BALF1-01      acgacaagg--------tcgcggag-----accagctacctcct--tttt
Q9Q5K8_BHRF1-01      acagcaagagaatcacctttcagcgtttctcctggcgaccctctggttct
Q9WGB5_BHRF1-01      acagcaagagaatcacctttcagcgtttctcctggcgaccctctggttct
                     **  ****         *  * * *      *  ** ***  **  ** *

Q99F66_BALF1-01      agggccatgtacgc----------ggtgttcacccaggacgagactgacc
Q9Q5K8_BHRF1-01      gcgtttacatgcgctacttgagcagataattgtccagaatgaggatg---
Q9WGB5_BHRF1-01      gcgtttacatgcgctacttgagcaaataattgtccagaatgaggatg---
                       *   *  * ***            *  *   **** * ***  **   

Q99F66_BALF1-01      tgcccaccccagctcaggtcctgtgccggctcatcaaggcctccctcaga
Q9Q5K8_BHRF1-01      ------cctttgcagagactttggtc------------acatttctcttg
Q9WGB5_BHRF1-01      ------cctttgcagagactttggac------------agatttctcttg
                           **   **  **    **  *               *  ***   

Q99F66_BALF1-01      aaggacaagaaactgtacgcggagctggcctgcaagacggcggacattgg
Q9Q5K8_BHRF1-01      aacactgaagacctggacctggatttttccagagtgtttgcggaaatt--
Q9WGB5_BHRF1-01      aacactgaagacctggacctggatttttccagagtgtttgcggaaatt--
                     **     *  * *** **  ***  *  ** *   *   ***** ***  

Q99F66_BALF1-01      aggcaagcacgcccacgtgcagctcatcatcagcatcctgcgcgccgtgt
Q9Q5K8_BHRF1-01      ---------------------tttcacaatgaagacccaaca---cttgg
Q9WGB5_BHRF1-01      ---------------------tttcacaatgaagacccaaca---cttgg
                                            ***  ** *  * **  *    * ** 

Q99F66_BALF1-01      acgacgaccactacgactactggtcgcggctcagggtggtgctgtgc-ta
Q9Q5K8_BHRF1-01      gcgaggat------------------tggctt-ggctggcctggtgcatg
Q9WGB5_BHRF1-01      gcgaggat------------------tggctt-ggctggcctggtgcatg
                      *** **                    ****  ** ***    **** * 

Q99F66_BALF1-01      cgcggttgtg----tttgcggtgcgaaactacctggatgaccacgagagt
Q9Q5K8_BHRF1-01      catgcctgcagaactttatgtggtgacactaactg--tccctactatgtt
Q9WGB5_BHRF1-01      catgcctgcagaactttatgtggtgacactaactg--tccctactatgtt
                     *  *  **      ***  *  * ** **** ***  *  * ** *   *

Q99F66_BALF1-01      gccgccttcg------------tgctgggggccaccgcccactacctggc
Q9Q5K8_BHRF1-01      gtggacctggcagttcgtggaatgttagaagccagcga---------agg
Q9WGB5_BHRF1-01      gtggacctggcagttcgtggaatgttagaagccagcga---------agg
                     *  * * * *            ** * *  **** **           * 

Q99F66_BALF1-01      cctctatcgccgtgtctggtttgccaggattgg---cggcctgcccaggt
Q9Q5K8_BHRF1-01      tcttgatggttg-----gattggtcaacatgggggctggcctgct---gt
Q9WGB5_BHRF1-01      tcttgatggttg-----gattggtcaacatgggggctggcctgct---gt
                      **  ** *  *     * ** * **  ** **    *******    **

Q99F66_BALF1-01      cgctgagacgccaattccctg------------taacatgggctatcgcc
Q9Q5K8_BHRF1-01      c-ctgagaggcaacccttctggcaccagaagctcaagatggactatcgtt
Q9WGB5_BHRF1-01      c-ctgagaggcaacccttctggcaccagaagctcaagatggactatcgtt
                     * ****** ** *     ***             ** **** ******  

Q99F66_BALF1-01      agcctgtcggacttcct------------------------gaaatcttt
Q9Q5K8_BHRF1-01      --tttactggactgactttaagtttgttagttgtgtgtagctatatcttt
Q9WGB5_BHRF1-01      --tttactggactgactttaagtttgttagttgtgtgtagctatatcttt
                         *   *****  **                         * ******

Q99F66_BALF1-01      g--------------taa
Q9Q5K8_BHRF1-01      atttctagaagacactaa
Q9WGB5_BHRF1-01      atttctagaagacactaa

© 1998-2019