Dataset for CDS BHRF1 of organism Cercopithecine herpesvirus 12

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q9Q5K8_BHRF1-01      atggcctattctacaagggatttactgttagctttgtgtatgcgggatgg
Q9WGB5_BHRF1-01      atggcctattctacaagggatttactgttagctttgtgtatgcgggatgg

Q9Q5K8_BHRF1-01      tcacgtttatggaggcgacggtttgcatcctgtgttggagttgacagcaa
Q9WGB5_BHRF1-01      tcacgtttatggaggcgacggtttgcatcctgtgttggagttgacagcaa

Q9Q5K8_BHRF1-01      gagaatcacctttcagcgtttctcctggcgaccctctggttctgcgttta
Q9WGB5_BHRF1-01      gagaatcacctttcagcgtttctcctggcgaccctctggttctgcgttta

Q9Q5K8_BHRF1-01      catgcgctacttgagcagataattgtccagaatgaggatgcctttgcaga
Q9WGB5_BHRF1-01      catgcgctacttgagcaaataattgtccagaatgaggatgcctttgcaga
                     ***************** ********************************

Q9Q5K8_BHRF1-01      gactttggtcacatttctcttgaacactgaagacctggacctggattttt
Q9WGB5_BHRF1-01      gactttggacagatttctcttgaacactgaagacctggacctggattttt
                     ******** ** **************************************

Q9Q5K8_BHRF1-01      ccagagtgtttgcggaaatttttcacaatgaagacccaacacttgggcga
Q9WGB5_BHRF1-01      ccagagtgtttgcggaaatttttcacaatgaagacccaacacttgggcga

Q9Q5K8_BHRF1-01      ggattggcttggctggcctggtgcatgcatgcctgcagaactttatgtgg
Q9WGB5_BHRF1-01      ggattggcttggctggcctggtgcatgcatgcctgcagaactttatgtgg

Q9Q5K8_BHRF1-01      tgacactaactgtccctactatgttgtggacctggcagttcgtggaatgt
Q9WGB5_BHRF1-01      tgacactaactgtccctactatgttgtggacctggcagttcgtggaatgt

Q9Q5K8_BHRF1-01      tagaagccagcgaaggtcttgatggttggattggtcaacatgggggctgg
Q9WGB5_BHRF1-01      tagaagccagcgaaggtcttgatggttggattggtcaacatgggggctgg

Q9Q5K8_BHRF1-01      cctgctgtcctgagaggcaacccttctggcaccagaagctcaagatggac
Q9WGB5_BHRF1-01      cctgctgtcctgagaggcaacccttctggcaccagaagctcaagatggac

Q9Q5K8_BHRF1-01      tatcgtttttactggactgactttaagtttgttagttgtgtgtagctata
Q9WGB5_BHRF1-01      tatcgtttttactggactgactttaagtttgttagttgtgtgtagctata

Q9Q5K8_BHRF1-01      tctttatttctagaagacactaa
Q9WGB5_BHRF1-01      tctttatttctagaagacactaa

© 1998-2019