Dataset for CDS V-BCL-2 of organism Bovine herpesvirus 4

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q1XBS8_VBCL2-01      atgtctctgttttttattgtttggtactgggtgaattatataacaaaggt
Q1XBS6_VBCL2-01      atgtctctgttttttgttgtttggtactgggtgaattatataacaaaggt
Q1XBS7_VBCL2-01      atgtctctgttttttgttgtttggtactgggtgaattatataacaaaggt
Q99D15_VBCL2-01      atgtctctgttttttgttgtttggtactgggtgaattatataacaaaggt
Q9WH78_VBCL2-01      atgtctctgttttttgttgtttggtactgggtgaattatataacaaaggt
                     *************** **********************************

Q1XBS8_VBCL2-01      gtgttctggggaggtatatattccaagtgtattaaagtttcaatatcact
Q1XBS6_VBCL2-01      gtgttctggggaggtatatattccaagtgtattaaagtttcaatatcact
Q1XBS7_VBCL2-01      gtgttctggggaggtatatattccaagtgtattaaagtttcaatatcact
Q99D15_VBCL2-01      gtgttttggggaggtatatattccaagtgtattaaagtttcaatatcact
Q9WH78_VBCL2-01      gtgttctggggaggtatatattccaagtgtattaaagtttcaatatcact
                     ***** ********************************************

Q1XBS8_VBCL2-01      ctgacactgaacacgagccttactctaatctgtgtgaaaacttgataacc
Q1XBS6_VBCL2-01      ctgacactgaacacgagccttactccaatctgtgtgaaaacttgataacc
Q1XBS7_VBCL2-01      ctgacactgaacacgagccttactccaatctgtgtgaaaacttgataacc
Q99D15_VBCL2-01      ctgacactgaacacgagccttactccaatctgtgtaaaaacttgataacc
Q9WH78_VBCL2-01      ctgacactgaacacgagccttactccaatctgtgtaaaaacttgataacc
                     ************************* ********* **************

Q1XBS8_VBCL2-01      atggccgagcaggacatggatgaggtggtctccacaatcaggaggctctt
Q1XBS6_VBCL2-01      atggccgagcaggacatggatgaggtggtctccacaatcaggaggctctt
Q1XBS7_VBCL2-01      atggccgagcaggacatggatgaggtggtctccacaatcaggaggctctt
Q99D15_VBCL2-01      atggccgagcaggacatggatgaggtggtctccacaatcaggaggctctt
Q9WH78_VBCL2-01      atggccgagcaggacatggatgaggtggtctccacaatcaggaggctctt

Q1XBS8_VBCL2-01      ggtggaatgtggtatgggattggaagaatatttagaccatcccgtaacag
Q1XBS6_VBCL2-01      ggtggaatgtggtatgggattggaagaatatttagaccatcccgtaacag
Q1XBS7_VBCL2-01      ggtggaatgtggtatgggattggaagaatatttagaacaccctgtaacag
Q99D15_VBCL2-01      ggtggaatgtggtatgggattggaagaatatttagaacaccctgtaacag
Q9WH78_VBCL2-01      ggtggaatgtggtatgggattggaagaatatttagaacaccctgtaacag
                     ************************************ ** ** *******

Q1XBS8_VBCL2-01      cccccataaaggtggctgtccaggatgtgatcagaacaaaacaggacatc
Q1XBS6_VBCL2-01      cccccataaaggtggctgtccaggatgtgatcagaacaaaacaggacatc
Q1XBS7_VBCL2-01      cccccataaaggtggctgtccaggatgtgatcagaacaaaacaggacatc
Q99D15_VBCL2-01      cccccataaaggtggctgtccaggatgtgatcagaacaaaacaggacatc
Q9WH78_VBCL2-01      cccccataaaggtggctgtccaggatgtgatcagaacaaaacaggacatc

Q1XBS8_VBCL2-01      tttagcaattttttaacaaatattaattctgtggaggatttggagaccct
Q1XBS6_VBCL2-01      tttagcaattttttaacaaatattaattctgtggaggatttggagaccct
Q1XBS7_VBCL2-01      tttagcaattttttaacaaatattaattctgtggaggatttggagaccct
Q99D15_VBCL2-01      tttagcaattttttaacaaatattaattctgtggaagatttggaaaccct
Q9WH78_VBCL2-01      tttagcaattttttaacaaatattaattctgtggaagatttggaaaccct
                     *********************************** ******** *****

Q1XBS8_VBCL2-01      gggccacgccatcactacgttaaatgactacccctccccaaacatgggca
Q1XBS6_VBCL2-01      gggccacgccatcactacgttaaatgactatccctccccaaacatgggca
Q1XBS7_VBCL2-01      gggccacgccatcactacgttaaatgactatccctccccaaacatgggca
Q99D15_VBCL2-01      gggccacgccatcactacgttaaatgactatccctccccaaacatgggca
Q9WH78_VBCL2-01      gggccatgccatcactacgttaaatgactatccctccccaaacatgggca
                     ****** *********************** *******************

Q1XBS8_VBCL2-01      gagttgtatgtggcatagcattctctgtctatgttgtccagactgtgtgt
Q1XBS6_VBCL2-01      gagttgtatgtggcatagcattctctgtctatgttgtccagactgtgtgt
Q1XBS7_VBCL2-01      gagttgtatgtggcatagcattctctgtctatgttgtccagactgtgtgt
Q99D15_VBCL2-01      gagttgtatgtggcatagcattttctgtctatgttgtccagactgtctgt
Q9WH78_VBCL2-01      gagttgtatgtggcatagcattttctgtctatgttgtccagactgtctgt
                     ********************** *********************** ***

Q1XBS8_VBCL2-01      aagagaaaaccactattggtcaggtgctgcctagacatctttacgagagc
Q1XBS6_VBCL2-01      aagagaaaaccactattggtcaggtgctgcctagacatctttacgagagc
Q1XBS7_VBCL2-01      aagagaaaaccactattggtcaggtgctgcctagacatctttacgagagc
Q99D15_VBCL2-01      aagaggaaaccactattggtcaggtgctgcttagacatctttacgagagc
Q9WH78_VBCL2-01      aagagaaaaccactattggtcaggtgctgcttagacatctttacgagagc
                     ***** ************************ *******************

Q1XBS8_VBCL2-01      cactgtccaggctttgaatgttaattggtttttgcaggaaggtgggtggc
Q1XBS6_VBCL2-01      cactgtccaggctttgaatgttaattggtttttgcaggaaggtgggtggc
Q1XBS7_VBCL2-01      cactgtccaggctttgaatgttaattggtttttgcaggaaggtgggtggc
Q99D15_VBCL2-01      cactgtccaggctttgaatgttaattggtttttacaggaaggtgggtggc
Q9WH78_VBCL2-01      cactgtccaggctttgaatgttaattggtttttacaggaaggtgggtggc
                     ********************************* ****************

Q1XBS8_VBCL2-01      cggctcttgcatcattctgcaaggtggttaatagcccaagcccccgctcc
Q1XBS6_VBCL2-01      cggctcttgcatcattctgcaaggtggttaatagcccaagcccccgctcc
Q1XBS7_VBCL2-01      cggctcttgcatcattctgcaaggtggttaatagcccaagcccccgctcc
Q99D15_VBCL2-01      cggcccttgcatcattctgcaaggtggttaatagcccaagcccccgctcc
Q9WH78_VBCL2-01      cggcccttgcatcattctgcaaggtggttaatagcccaagcccccgctcc
                     **** *********************************************

Q1XBS8_VBCL2-01      agatggttatttcccatgcttgccatctccggcctggtactgactgtggg
Q1XBS6_VBCL2-01      agatggttatttcccatgcttgccatctccggcctggtactgactgtggg
Q1XBS7_VBCL2-01      agatggttatttcccatgcttgccatctccggcctggtactgactgtggg
Q99D15_VBCL2-01      agatggttatttcccatgtttgccatctccggcctggtactgactgtggg
Q9WH78_VBCL2-01      agatggttatttcccatgtttgccatctccggcctggtactgactgtggg
                     ****************** *******************************

Q1XBS8_VBCL2-01      tgtggcgagaaacatggtacattttacctaa
Q1XBS6_VBCL2-01      tgtggcgagaaacatggtacattttacctaa
Q1XBS7_VBCL2-01      tgtggcgagaaacatggtacattttacctaa
Q99D15_VBCL2-01      tgtggctagaaatatggtacattttacctaa
Q9WH78_VBCL2-01      tgttgctagaaatatggtacattttacctaa
                     *** ** ***** ******************

© 1998-2019